FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624171_at:

>probe:Drosophila_2:1624171_at:394:333; Interrogation_Position=141; Antisense; GCTAGTTTCCCAGGCAATCGAGCTG
>probe:Drosophila_2:1624171_at:444:215; Interrogation_Position=182; Antisense; AAGATCTGATCGTCTTGGACTCGCA
>probe:Drosophila_2:1624171_at:399:107; Interrogation_Position=206; Antisense; AGAACTCCATTCTGTTGGGCTACTT
>probe:Drosophila_2:1624171_at:187:595; Interrogation_Position=221; Antisense; TGGGCTACTTGGATCGCTTCGATGC
>probe:Drosophila_2:1624171_at:602:447; Interrogation_Position=241; Antisense; GATGCCTTCACTGCCGTAAATGCGA
>probe:Drosophila_2:1624171_at:547:667; Interrogation_Position=29; Antisense; TACTAGGTTTTCTACTCGTGCTGAC
>probe:Drosophila_2:1624171_at:468:643; Interrogation_Position=315; Antisense; TCTAGATTCGGATACCACGGGAGAT
>probe:Drosophila_2:1624171_at:577:423; Interrogation_Position=345; Antisense; GAGAACTTCCAGTATCGAGACCCAG
>probe:Drosophila_2:1624171_at:339:425; Interrogation_Position=361; Antisense; GAGACCCAGTTGATTGCGCTTTGCT
>probe:Drosophila_2:1624171_at:516:273; Interrogation_Position=384; Antisense; CTTGCAGCGCAACGGATTCGATCGA
>probe:Drosophila_2:1624171_at:229:717; Interrogation_Position=400; Antisense; TTCGATCGATGGAAGCGCACGGTTC
>probe:Drosophila_2:1624171_at:94:611; Interrogation_Position=50; Antisense; TGACCCCTTCTTTGATCAATACCTA
>probe:Drosophila_2:1624171_at:603:387; Interrogation_Position=528; Antisense; GAAAATCTTGACTCGTGGCGGACCC
>probe:Drosophila_2:1624171_at:351:219; Interrogation_Position=84; Antisense; AAGTCGCTATCGGTTGTATTTGCAA

Paste this into a BLAST search page for me
GCTAGTTTCCCAGGCAATCGAGCTGAAGATCTGATCGTCTTGGACTCGCAAGAACTCCATTCTGTTGGGCTACTTTGGGCTACTTGGATCGCTTCGATGCGATGCCTTCACTGCCGTAAATGCGATACTAGGTTTTCTACTCGTGCTGACTCTAGATTCGGATACCACGGGAGATGAGAACTTCCAGTATCGAGACCCAGGAGACCCAGTTGATTGCGCTTTGCTCTTGCAGCGCAACGGATTCGATCGATTCGATCGATGGAAGCGCACGGTTCTGACCCCTTCTTTGATCAATACCTAGAAAATCTTGACTCGTGGCGGACCCAAGTCGCTATCGGTTGTATTTGCAA

Full Affymetrix probeset data:

Annotations for 1624171_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720