FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624172_at:

>probe:Drosophila_2:1624172_at:416:615; Interrogation_Position=1475; Antisense; TGAATCGAGCTGCTGGTCTCATGCA
>probe:Drosophila_2:1624172_at:78:579; Interrogation_Position=1619; Antisense; TGACCGTTTTTCAGGAGGAGGCCCT
>probe:Drosophila_2:1624172_at:157:327; Interrogation_Position=1650; Antisense; GCGACCGCAGGGAATCCATTTCATT
>probe:Drosophila_2:1624172_at:347:25; Interrogation_Position=1676; Antisense; ATACGCCCAACGGATTTGACACCAT
>probe:Drosophila_2:1624172_at:411:247; Interrogation_Position=1785; Antisense; AATTGAAGTTCTCTTACACCGCCAG
>probe:Drosophila_2:1624172_at:135:313; Interrogation_Position=1805; Antisense; GCCAGCTCTACGTTCATGGAAGCAA
>probe:Drosophila_2:1624172_at:294:439; Interrogation_Position=1834; Antisense; GAGGCACTCTACAATCAGATTCCCA
>probe:Drosophila_2:1624172_at:514:545; Interrogation_Position=1894; Antisense; GGATCGATTCCGGAGCTGCTGCAGC
>probe:Drosophila_2:1624172_at:385:517; Interrogation_Position=1920; Antisense; GTGGGAGCAGCGTATTCTAGCCTAC
>probe:Drosophila_2:1624172_at:123:643; Interrogation_Position=1935; Antisense; TCTAGCCTACCGGAATTACTGGGAG
>probe:Drosophila_2:1624172_at:7:175; Interrogation_Position=1985; Antisense; AAAGCCTCCGAGTGGGTCAGCCTGT
>probe:Drosophila_2:1624172_at:72:497; Interrogation_Position=2000; Antisense; GTCAGCCTGTTGACTTCGAGAGTCT
>probe:Drosophila_2:1624172_at:189:101; Interrogation_Position=2018; Antisense; AGAGTCTTTTTGGTCTGCAGGGCTC
>probe:Drosophila_2:1624172_at:537:571; Interrogation_Position=2038; Antisense; GGCTCCTTCCGGCAATTGAATGTGG

Paste this into a BLAST search page for me
TGAATCGAGCTGCTGGTCTCATGCATGACCGTTTTTCAGGAGGAGGCCCTGCGACCGCAGGGAATCCATTTCATTATACGCCCAACGGATTTGACACCATAATTGAAGTTCTCTTACACCGCCAGGCCAGCTCTACGTTCATGGAAGCAAGAGGCACTCTACAATCAGATTCCCAGGATCGATTCCGGAGCTGCTGCAGCGTGGGAGCAGCGTATTCTAGCCTACTCTAGCCTACCGGAATTACTGGGAGAAAGCCTCCGAGTGGGTCAGCCTGTGTCAGCCTGTTGACTTCGAGAGTCTAGAGTCTTTTTGGTCTGCAGGGCTCGGCTCCTTCCGGCAATTGAATGTGG

Full Affymetrix probeset data:

Annotations for 1624172_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720