Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624173_at:

>probe:Drosophila_2:1624173_at:427:547; Interrogation_Position=1138; Antisense; GGATGTGGCTCAATCGCGCACCGAT
>probe:Drosophila_2:1624173_at:184:375; Interrogation_Position=1171; Antisense; GAAGATTGCCTTCATGTATCGCGGC
>probe:Drosophila_2:1624173_at:574:483; Interrogation_Position=1186; Antisense; GTATCGCGGCATGACGCCCGAAGAA
>probe:Drosophila_2:1624173_at:195:191; Interrogation_Position=1209; Antisense; AACTTCGCGTGTTTCGTCTTGGACA
>probe:Drosophila_2:1624173_at:572:35; Interrogation_Position=1236; Antisense; ATCAGCAGCTTCGTTTGTCTATTCA
>probe:Drosophila_2:1624173_at:245:13; Interrogation_Position=1256; Antisense; ATTCAGCGCAAGACGGAGGCCCAGA
>probe:Drosophila_2:1624173_at:676:333; Interrogation_Position=1381; Antisense; GCTGATGCGGGCGAATTCCAAGTTG
>probe:Drosophila_2:1624173_at:138:559; Interrogation_Position=1432; Antisense; GGAAGCCCTTGTGGGCCTAACCAAT
>probe:Drosophila_2:1624173_at:324:497; Interrogation_Position=1460; Antisense; GTCTCCGATGACTTTTACGATCAGT
>probe:Drosophila_2:1624173_at:110:213; Interrogation_Position=1518; Antisense; AAGTTCCCAACCAAGACGATTCGAG
>probe:Drosophila_2:1624173_at:515:447; Interrogation_Position=1555; Antisense; GATGCGATTAGAAAGCTGCCTCACT
>probe:Drosophila_2:1624173_at:443:597; Interrogation_Position=1584; Antisense; TGTGCAGCAACTTTCCATAGGCGTC
>probe:Drosophila_2:1624173_at:538:679; Interrogation_Position=1601; Antisense; TAGGCGTCCAGAACATTGTACTATT
>probe:Drosophila_2:1624173_at:542:35; Interrogation_Position=1637; Antisense; ATCTTTGTTGGGAATCTTCACGACG

Paste this into a BLAST search page for me
GGATGTGGCTCAATCGCGCACCGATGAAGATTGCCTTCATGTATCGCGGCGTATCGCGGCATGACGCCCGAAGAAAACTTCGCGTGTTTCGTCTTGGACAATCAGCAGCTTCGTTTGTCTATTCAATTCAGCGCAAGACGGAGGCCCAGAGCTGATGCGGGCGAATTCCAAGTTGGGAAGCCCTTGTGGGCCTAACCAATGTCTCCGATGACTTTTACGATCAGTAAGTTCCCAACCAAGACGATTCGAGGATGCGATTAGAAAGCTGCCTCACTTGTGCAGCAACTTTCCATAGGCGTCTAGGCGTCCAGAACATTGTACTATTATCTTTGTTGGGAATCTTCACGACG

Full Affymetrix probeset data:

Annotations for 1624173_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime