FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624175_at:

>probe:Drosophila_2:1624175_at:635:115; Interrogation_Position=3276; Antisense; AGCTACTACTACTCCAACGTGTTAT
>probe:Drosophila_2:1624175_at:268:405; Interrogation_Position=3326; Antisense; GACTAACATTTCCTACCTTAAGTGC
>probe:Drosophila_2:1624175_at:244:457; Interrogation_Position=3377; Antisense; GATAGCTACCGCATAAGATCTTTAG
>probe:Drosophila_2:1624175_at:554:85; Interrogation_Position=3420; Antisense; AGTGCTAGTATCCTGTGAATTTCCA
>probe:Drosophila_2:1624175_at:336:359; Interrogation_Position=3466; Antisense; GAATTTGCCTAACCCATTTGGACCT
>probe:Drosophila_2:1624175_at:500:301; Interrogation_Position=3478; Antisense; CCCATTTGGACCTTTGACTTTCAAT
>probe:Drosophila_2:1624175_at:355:493; Interrogation_Position=3497; Antisense; TTCAATAACGTATACTCGGCCAAAT
>probe:Drosophila_2:1624175_at:549:655; Interrogation_Position=3525; Antisense; TAATCCGTGCACACACATTAATAGT
>probe:Drosophila_2:1624175_at:123:667; Interrogation_Position=3584; Antisense; TACACACACACACCATTCGTTTGAT
>probe:Drosophila_2:1624175_at:516:685; Interrogation_Position=3661; Antisense; TATACGAGCAATTATCTGCGCTAAT
>probe:Drosophila_2:1624175_at:276:13; Interrogation_Position=3693; Antisense; ATTCACACTTTACTTCTTCGTACAC
>probe:Drosophila_2:1624175_at:39:159; Interrogation_Position=3714; Antisense; ACACAAAGGCACTTGCGTTCGGCAA
>probe:Drosophila_2:1624175_at:4:567; Interrogation_Position=3734; Antisense; GGCAAACTGGTTCGAGACACATCTA
>probe:Drosophila_2:1624175_at:721:167; Interrogation_Position=3820; Antisense; AAAGTTGAGTACACCATTTATTCGC

Paste this into a BLAST search page for me
AGCTACTACTACTCCAACGTGTTATGACTAACATTTCCTACCTTAAGTGCGATAGCTACCGCATAAGATCTTTAGAGTGCTAGTATCCTGTGAATTTCCAGAATTTGCCTAACCCATTTGGACCTCCCATTTGGACCTTTGACTTTCAATTTCAATAACGTATACTCGGCCAAATTAATCCGTGCACACACATTAATAGTTACACACACACACCATTCGTTTGATTATACGAGCAATTATCTGCGCTAATATTCACACTTTACTTCTTCGTACACACACAAAGGCACTTGCGTTCGGCAAGGCAAACTGGTTCGAGACACATCTAAAAGTTGAGTACACCATTTATTCGC

Full Affymetrix probeset data:

Annotations for 1624175_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720