Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624176_at:

>probe:Drosophila_2:1624176_at:680:641; Interrogation_Position=2082; Antisense; TCTCCTCTTTTCGTCTCTTTGGGTT
>probe:Drosophila_2:1624176_at:614:515; Interrogation_Position=2099; Antisense; TTTGGGTTACCCACTTCTCATGTTG
>probe:Drosophila_2:1624176_at:532:133; Interrogation_Position=2107; Antisense; ACCCACTTCTCATGTTGGTGTGAAA
>probe:Drosophila_2:1624176_at:255:369; Interrogation_Position=2134; Antisense; GAATGCCAGTCCAATATATTCGCAC
>probe:Drosophila_2:1624176_at:597:709; Interrogation_Position=2172; Antisense; TTCAGTTTAACGATGTATACGCAAA
>probe:Drosophila_2:1624176_at:572:705; Interrogation_Position=2279; Antisense; TTAAAAGCTCTTTCTGTTGCATTTA
>probe:Drosophila_2:1624176_at:275:603; Interrogation_Position=2296; Antisense; TGCATTTACGTTTTGCTAGTTTTAA
>probe:Drosophila_2:1624176_at:322:539; Interrogation_Position=2350; Antisense; GGTTTTGTAATTTCTACTGTTCCAT
>probe:Drosophila_2:1624176_at:169:377; Interrogation_Position=2409; Antisense; GAAGCTTGCTTACACAAAATATTTG
>probe:Drosophila_2:1624176_at:565:23; Interrogation_Position=2464; Antisense; ATATGTGCGTATGTTACGTTGCATA
>probe:Drosophila_2:1624176_at:284:139; Interrogation_Position=2479; Antisense; ACGTTGCATACGGTGTACATCGAGT
>probe:Drosophila_2:1624176_at:79:191; Interrogation_Position=2530; Antisense; AACTTATCAATCTATGCAACTGCAA
>probe:Drosophila_2:1624176_at:683:183; Interrogation_Position=2556; Antisense; AAAATGTGACTTGAACTTGTTTGCG
>probe:Drosophila_2:1624176_at:113:481; Interrogation_Position=2574; Antisense; GTTTGCGCCAATTAAGTTATGTACG

Paste this into a BLAST search page for me
TCTCCTCTTTTCGTCTCTTTGGGTTTTTGGGTTACCCACTTCTCATGTTGACCCACTTCTCATGTTGGTGTGAAAGAATGCCAGTCCAATATATTCGCACTTCAGTTTAACGATGTATACGCAAATTAAAAGCTCTTTCTGTTGCATTTATGCATTTACGTTTTGCTAGTTTTAAGGTTTTGTAATTTCTACTGTTCCATGAAGCTTGCTTACACAAAATATTTGATATGTGCGTATGTTACGTTGCATAACGTTGCATACGGTGTACATCGAGTAACTTATCAATCTATGCAACTGCAAAAAATGTGACTTGAACTTGTTTGCGGTTTGCGCCAATTAAGTTATGTACG

Full Affymetrix probeset data:

Annotations for 1624176_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime