FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624177_at:

>probe:Drosophila_2:1624177_at:244:129; Interrogation_Position=14; Antisense; ACCATTCAGAGTCGTCTCTCAGTTT
>probe:Drosophila_2:1624177_at:211:709; Interrogation_Position=18; Antisense; TTCAGAGTCGTCTCTCAGTTTAGAC
>probe:Drosophila_2:1624177_at:182:99; Interrogation_Position=21; Antisense; AGAGTCGTCTCTCAGTTTAGACAAA
>probe:Drosophila_2:1624177_at:258:501; Interrogation_Position=24; Antisense; GTCGTCTCTCAGTTTAGACAAACGC
>probe:Drosophila_2:1624177_at:83:695; Interrogation_Position=36; Antisense; TTTAGACAAACGCACTCCAAGCCAG
>probe:Drosophila_2:1624177_at:317:261; Interrogation_Position=407; Antisense; CACCCATCCCCAATACGTCGAGCAG
>probe:Drosophila_2:1624177_at:341:177; Interrogation_Position=43; Antisense; AAACGCACTCCAAGCCAGCAAAGAT
>probe:Drosophila_2:1624177_at:556:497; Interrogation_Position=459; Antisense; GTCTTTGGTTAAGCGGGAGCGGAAG
>probe:Drosophila_2:1624177_at:702:297; Interrogation_Position=46; Antisense; CGCACTCCAAGCCAGCAAAGATGTT
>probe:Drosophila_2:1624177_at:75:291; Interrogation_Position=472; Antisense; CGGGAGCGGAAGTCTTATGTGATAA
>probe:Drosophila_2:1624177_at:117:121; Interrogation_Position=476; Antisense; AGCGGAAGTCTTATGTGATAACATT
>probe:Drosophila_2:1624177_at:390:145; Interrogation_Position=49; Antisense; ACTCCAAGCCAGCAAAGATGTTCCG
>probe:Drosophila_2:1624177_at:372:127; Interrogation_Position=55; Antisense; AGCCAGCAAAGATGTTCCGCTACCT
>probe:Drosophila_2:1624177_at:124:113; Interrogation_Position=59; Antisense; AGCAAAGATGTTCCGCTACCTGCTC

Paste this into a BLAST search page for me
ACCATTCAGAGTCGTCTCTCAGTTTTTCAGAGTCGTCTCTCAGTTTAGACAGAGTCGTCTCTCAGTTTAGACAAAGTCGTCTCTCAGTTTAGACAAACGCTTTAGACAAACGCACTCCAAGCCAGCACCCATCCCCAATACGTCGAGCAGAAACGCACTCCAAGCCAGCAAAGATGTCTTTGGTTAAGCGGGAGCGGAAGCGCACTCCAAGCCAGCAAAGATGTTCGGGAGCGGAAGTCTTATGTGATAAAGCGGAAGTCTTATGTGATAACATTACTCCAAGCCAGCAAAGATGTTCCGAGCCAGCAAAGATGTTCCGCTACCTAGCAAAGATGTTCCGCTACCTGCTC

Full Affymetrix probeset data:

Annotations for 1624177_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720