Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624178_s_at:

>probe:Drosophila_2:1624178_s_at:388:715; Interrogation_Position=115; Antisense; TTCGAGGAGATTTTGCCTTCGGCGG
>probe:Drosophila_2:1624178_s_at:69:53; Interrogation_Position=13; Antisense; ATGCTTCTCAAGGTATTTTTACTGG
>probe:Drosophila_2:1624178_s_at:298:643; Interrogation_Position=132; Antisense; TTCGGCGGTTCCCTTTGAGACCTCA
>probe:Drosophila_2:1624178_s_at:87:425; Interrogation_Position=148; Antisense; GAGACCTCACACAAACATCCGGGTG
>probe:Drosophila_2:1624178_s_at:18:521; Interrogation_Position=183; Antisense; GGTGGAGGGATTTCAAACCTCCCAT
>probe:Drosophila_2:1624178_s_at:77:163; Interrogation_Position=209; Antisense; AAATAAGCATAAGGGCCACCGATTC
>probe:Drosophila_2:1624178_s_at:37:305; Interrogation_Position=227; Antisense; CCGATTCCGCTGACTATTCGATGAA
>probe:Drosophila_2:1624178_s_at:576:9; Interrogation_Position=242; Antisense; ATTCGATGAATCTGCTGCCTACTAA
>probe:Drosophila_2:1624178_s_at:728:557; Interrogation_Position=257; Antisense; TGCCTACTAAAGAGCGACCCGAATT
>probe:Drosophila_2:1624178_s_at:519:689; Interrogation_Position=26; Antisense; TATTTTTACTGGTCTTCATCGCCAC
>probe:Drosophila_2:1624178_s_at:245:245; Interrogation_Position=278; Antisense; AATTGAACCCCGTTTTGAGTGCACT
>probe:Drosophila_2:1624178_s_at:131:193; Interrogation_Position=283; Antisense; AACCCCGTTTTGAGTGCACTTATCA
>probe:Drosophila_2:1624178_s_at:110:127; Interrogation_Position=53; Antisense; ACCACTTGGTAGACTCAGCGGGTCC
>probe:Drosophila_2:1624178_s_at:520:603; Interrogation_Position=75; Antisense; TCCCCTTTCCAATATAGCCAGCGAA

Paste this into a BLAST search page for me
TTCGAGGAGATTTTGCCTTCGGCGGATGCTTCTCAAGGTATTTTTACTGGTTCGGCGGTTCCCTTTGAGACCTCAGAGACCTCACACAAACATCCGGGTGGGTGGAGGGATTTCAAACCTCCCATAAATAAGCATAAGGGCCACCGATTCCCGATTCCGCTGACTATTCGATGAAATTCGATGAATCTGCTGCCTACTAATGCCTACTAAAGAGCGACCCGAATTTATTTTTACTGGTCTTCATCGCCACAATTGAACCCCGTTTTGAGTGCACTAACCCCGTTTTGAGTGCACTTATCAACCACTTGGTAGACTCAGCGGGTCCTCCCCTTTCCAATATAGCCAGCGAA

Full Affymetrix probeset data:

Annotations for 1624178_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime