Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624179_at:

>probe:Drosophila_2:1624179_at:726:517; Interrogation_Position=100; Antisense; GTGGAGGCTTCATAATATTTCAAAC
>probe:Drosophila_2:1624179_at:402:251; Interrogation_Position=124; Antisense; CAAGTACAAATACCTATCCACCGGA
>probe:Drosophila_2:1624179_at:257:381; Interrogation_Position=147; Antisense; GAAACCCCGAGTTCTACCAGTGGAT
>probe:Drosophila_2:1624179_at:256:79; Interrogation_Position=176; Antisense; AGGGTAAACACCGTTGCCGATGAAT
>probe:Drosophila_2:1624179_at:449:469; Interrogation_Position=188; Antisense; GTTGCCGATGAATTCAATCACTACA
>probe:Drosophila_2:1624179_at:105:209; Interrogation_Position=215; Antisense; AAGCATCGGCAAAGACTTGAGGATC
>probe:Drosophila_2:1624179_at:254:243; Interrogation_Position=241; Antisense; AATTACTGAGCGCTTGATAACGATC
>probe:Drosophila_2:1624179_at:214:199; Interrogation_Position=259; Antisense; AACGATCAGATCCATAATTGCCATA
>probe:Drosophila_2:1624179_at:718:425; Interrogation_Position=298; Antisense; GAGATGTCTTCGATTCTACCTTAAT
>probe:Drosophila_2:1624179_at:645:611; Interrogation_Position=337; Antisense; TGAAAGTGCCTACAAGTCCTCCAAT
>probe:Drosophila_2:1624179_at:165:99; Interrogation_Position=398; Antisense; AGATGCCCTCATGGATTGGATGACG
>probe:Drosophila_2:1624179_at:523:55; Interrogation_Position=417; Antisense; ATGACGGCAGGCTTGGTGACCCTTA
>probe:Drosophila_2:1624179_at:358:497; Interrogation_Position=432; Antisense; GTGACCCTTACTTTGTTGACTACTT
>probe:Drosophila_2:1624179_at:610:295; Interrogation_Position=45; Antisense; CGAATCTGGGCTTTGTTCTAAGTGA

Paste this into a BLAST search page for me
GTGGAGGCTTCATAATATTTCAAACCAAGTACAAATACCTATCCACCGGAGAAACCCCGAGTTCTACCAGTGGATAGGGTAAACACCGTTGCCGATGAATGTTGCCGATGAATTCAATCACTACAAAGCATCGGCAAAGACTTGAGGATCAATTACTGAGCGCTTGATAACGATCAACGATCAGATCCATAATTGCCATAGAGATGTCTTCGATTCTACCTTAATTGAAAGTGCCTACAAGTCCTCCAATAGATGCCCTCATGGATTGGATGACGATGACGGCAGGCTTGGTGACCCTTAGTGACCCTTACTTTGTTGACTACTTCGAATCTGGGCTTTGTTCTAAGTGA

Full Affymetrix probeset data:

Annotations for 1624179_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime