FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624180_at:

>probe:Drosophila_2:1624180_at:642:203; Interrogation_Position=1003; Antisense; AAGCCAAAGCGATGTTGCGCCACAT
>probe:Drosophila_2:1624180_at:599:603; Interrogation_Position=1015; Antisense; TGTTGCGCCACATTGTTACATATAA
>probe:Drosophila_2:1624180_at:556:189; Interrogation_Position=1124; Antisense; AACATATACACCAATGTCCAGCGTA
>probe:Drosophila_2:1624180_at:562:503; Interrogation_Position=1139; Antisense; GTCCAGCGTACATAGGTAGTTCGTT
>probe:Drosophila_2:1624180_at:709:15; Interrogation_Position=1178; Antisense; ATAGGACTTCTATTTCAGGGACCGT
>probe:Drosophila_2:1624180_at:311:713; Interrogation_Position=1191; Antisense; TTCAGGGACCGTAATGCTTATAAGT
>probe:Drosophila_2:1624180_at:508:87; Interrogation_Position=1213; Antisense; AGTCTGGATTGTGCTATTTGTTTAT
>probe:Drosophila_2:1624180_at:687:679; Interrogation_Position=817; Antisense; TAGGGCAGCCTGACCTCTCAAAAAT
>probe:Drosophila_2:1624180_at:720:157; Interrogation_Position=842; Antisense; ACACTTTTCATCTACTCTATGCACA
>probe:Drosophila_2:1624180_at:706:681; Interrogation_Position=859; Antisense; TATGCACACGGCTAAATCCATTTGT
>probe:Drosophila_2:1624180_at:681:267; Interrogation_Position=897; Antisense; CATGGGTTTCGCATACATCTACGCA
>probe:Drosophila_2:1624180_at:300:345; Interrogation_Position=919; Antisense; GCATAACTAAGCATCCAATCCGGGA
>probe:Drosophila_2:1624180_at:86:187; Interrogation_Position=958; Antisense; AACACATAGGAGCTGCCGTTCTGCG
>probe:Drosophila_2:1624180_at:603:289; Interrogation_Position=974; Antisense; CGTTCTGCGTTTTTCATTGACTTGG

Paste this into a BLAST search page for me
AAGCCAAAGCGATGTTGCGCCACATTGTTGCGCCACATTGTTACATATAAAACATATACACCAATGTCCAGCGTAGTCCAGCGTACATAGGTAGTTCGTTATAGGACTTCTATTTCAGGGACCGTTTCAGGGACCGTAATGCTTATAAGTAGTCTGGATTGTGCTATTTGTTTATTAGGGCAGCCTGACCTCTCAAAAATACACTTTTCATCTACTCTATGCACATATGCACACGGCTAAATCCATTTGTCATGGGTTTCGCATACATCTACGCAGCATAACTAAGCATCCAATCCGGGAAACACATAGGAGCTGCCGTTCTGCGCGTTCTGCGTTTTTCATTGACTTGG

Full Affymetrix probeset data:

Annotations for 1624180_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720