Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624181_at:

>probe:Drosophila_2:1624181_at:302:275; Interrogation_Position=2272; Antisense; CTTGACGGAGGCCTACGGTTATGCA
>probe:Drosophila_2:1624181_at:386:671; Interrogation_Position=2285; Antisense; TACGGTTATGCAGCCACCATTCATA
>probe:Drosophila_2:1624181_at:360:231; Interrogation_Position=2315; Antisense; AATGCACTCACCCTTTTGGCTTTAC
>probe:Drosophila_2:1624181_at:684:727; Interrogation_Position=2330; Antisense; TTGGCTTTACTCCTTTGGTTAGCTG
>probe:Drosophila_2:1624181_at:468:705; Interrogation_Position=2348; Antisense; TTAGCTGAGTCCGTGGTGCGCCGCA
>probe:Drosophila_2:1624181_at:693:505; Interrogation_Position=2363; Antisense; GTGCGCCGCATTTTGGGTATACCCT
>probe:Drosophila_2:1624181_at:634:479; Interrogation_Position=2379; Antisense; GTATACCCTCCAAAGGATTGGGCCA
>probe:Drosophila_2:1624181_at:186:439; Interrogation_Position=2410; Antisense; GAGGCATTCATACTAATCCGATTTG
>probe:Drosophila_2:1624181_at:325:517; Interrogation_Position=2447; Antisense; GTGTGAGCTGAAAACCTTCGTCGGA
>probe:Drosophila_2:1624181_at:371:639; Interrogation_Position=2464; Antisense; TCGTCGGAACTGAACTACTTGCTAT
>probe:Drosophila_2:1624181_at:255:25; Interrogation_Position=2487; Antisense; ATATGTCCATCCCAGTGTGCGAGAT
>probe:Drosophila_2:1624181_at:128:597; Interrogation_Position=2502; Antisense; TGTGCGAGATCATGGCTAACTTGGA
>probe:Drosophila_2:1624181_at:130:273; Interrogation_Position=2547; Antisense; CATACTTCCCGATTGATGTGTGCGA
>probe:Drosophila_2:1624181_at:660:709; Interrogation_Position=2614; Antisense; TTAACTAGCTCATAATCACCCATCG

Paste this into a BLAST search page for me
CTTGACGGAGGCCTACGGTTATGCATACGGTTATGCAGCCACCATTCATAAATGCACTCACCCTTTTGGCTTTACTTGGCTTTACTCCTTTGGTTAGCTGTTAGCTGAGTCCGTGGTGCGCCGCAGTGCGCCGCATTTTGGGTATACCCTGTATACCCTCCAAAGGATTGGGCCAGAGGCATTCATACTAATCCGATTTGGTGTGAGCTGAAAACCTTCGTCGGATCGTCGGAACTGAACTACTTGCTATATATGTCCATCCCAGTGTGCGAGATTGTGCGAGATCATGGCTAACTTGGACATACTTCCCGATTGATGTGTGCGATTAACTAGCTCATAATCACCCATCG

Full Affymetrix probeset data:

Annotations for 1624181_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime