FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624185_at:

>probe:Drosophila_2:1624185_at:230:91; Interrogation_Position=1788; Antisense; AGTAGTGTCTCATCAGACGTATGCT
>probe:Drosophila_2:1624185_at:351:409; Interrogation_Position=1803; Antisense; GACGTATGCTAAGCTGGCTCTTCAG
>probe:Drosophila_2:1624185_at:525:543; Interrogation_Position=1839; Antisense; GGATCGTCACCTGCTTGGACTGAAG
>probe:Drosophila_2:1624185_at:423:203; Interrogation_Position=1885; Antisense; AAGCCAATTCCCGAGTTCTTCAAGT
>probe:Drosophila_2:1624185_at:424:85; Interrogation_Position=1907; Antisense; AGTCGCCGGGCTTTGTTAAGTCCAG
>probe:Drosophila_2:1624185_at:191:475; Interrogation_Position=1921; Antisense; GTTAAGTCCAGTCACTTCCGCATGT
>probe:Drosophila_2:1624185_at:471:137; Interrogation_Position=1970; Antisense; ACGATGCTTTCATGGGATACGGCCC
>probe:Drosophila_2:1624185_at:539:299; Interrogation_Position=1992; Antisense; CCCGGCGACTGACGATGGTTATGCA
>probe:Drosophila_2:1624185_at:462:53; Interrogation_Position=2012; Antisense; ATGCATGCTGCTATAATCCTCGGGA
>probe:Drosophila_2:1624185_at:423:21; Interrogation_Position=2047; Antisense; ATATTGGCCATATCCGCTTGGCGCC
>probe:Drosophila_2:1624185_at:424:311; Interrogation_Position=2069; Antisense; GCCATTGCCCAATAACGGATCACTT
>probe:Drosophila_2:1624185_at:473:369; Interrogation_Position=2094; Antisense; GAAGTTCGTTAAGACCCTCGAGCAA
>probe:Drosophila_2:1624185_at:389:107; Interrogation_Position=2150; Antisense; AGAACCCGCCTGAGACTAAGTCGAA
>probe:Drosophila_2:1624185_at:387:65; Interrogation_Position=2262; Antisense; ATGGACAAACACTTGCTGCACTTGA

Paste this into a BLAST search page for me
AGTAGTGTCTCATCAGACGTATGCTGACGTATGCTAAGCTGGCTCTTCAGGGATCGTCACCTGCTTGGACTGAAGAAGCCAATTCCCGAGTTCTTCAAGTAGTCGCCGGGCTTTGTTAAGTCCAGGTTAAGTCCAGTCACTTCCGCATGTACGATGCTTTCATGGGATACGGCCCCCCGGCGACTGACGATGGTTATGCAATGCATGCTGCTATAATCCTCGGGAATATTGGCCATATCCGCTTGGCGCCGCCATTGCCCAATAACGGATCACTTGAAGTTCGTTAAGACCCTCGAGCAAAGAACCCGCCTGAGACTAAGTCGAAATGGACAAACACTTGCTGCACTTGA

Full Affymetrix probeset data:

Annotations for 1624185_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720