FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624186_at:

>probe:Drosophila_2:1624186_at:14:295; Interrogation_Position=1029; Antisense; CGAAGGCTACGGCATCACCAGCGAT
>probe:Drosophila_2:1624186_at:629:261; Interrogation_Position=1044; Antisense; CACCAGCGATGGCAGGATCATCTTT
>probe:Drosophila_2:1624186_at:101:545; Interrogation_Position=1058; Antisense; GGATCATCTTTGTGAATGCCTCAAC
>probe:Drosophila_2:1624186_at:500:49; Interrogation_Position=1073; Antisense; ATGCCTCAACGTGTGACATCAACTA
>probe:Drosophila_2:1624186_at:656:33; Interrogation_Position=1117; Antisense; ATCGTTTTCGATGTGACGCTGCCCC
>probe:Drosophila_2:1624186_at:478:301; Interrogation_Position=1140; Antisense; CCCCGGATTTCGCAAGGATTAGCAT
>probe:Drosophila_2:1624186_at:61:365; Interrogation_Position=1200; Antisense; GAATTTATTTTCGTCCCACTTTATG
>probe:Drosophila_2:1624186_at:263:575; Interrogation_Position=826; Antisense; TGGGCCTTTAATGTTCCACGTGGAA
>probe:Drosophila_2:1624186_at:192:309; Interrogation_Position=841; Antisense; CCACGTGGAACTGCCTGTTTGGATA
>probe:Drosophila_2:1624186_at:219:233; Interrogation_Position=876; Antisense; AATCCCGGAAGGCATCGATATCCTG
>probe:Drosophila_2:1624186_at:194:453; Interrogation_Position=931; Antisense; GATCTCTGCTGTTCCGGCGTACGAG
>probe:Drosophila_2:1624186_at:457:671; Interrogation_Position=950; Antisense; TACGAGCCGGTTGTGTGGAGCTACT
>probe:Drosophila_2:1624186_at:483:587; Interrogation_Position=965; Antisense; TGGAGCTACTCAGCACAGTGCAGCA
>probe:Drosophila_2:1624186_at:226:433; Interrogation_Position=992; Antisense; GAGTGCGCCCGAAATACCATGTCTT

Paste this into a BLAST search page for me
CGAAGGCTACGGCATCACCAGCGATCACCAGCGATGGCAGGATCATCTTTGGATCATCTTTGTGAATGCCTCAACATGCCTCAACGTGTGACATCAACTAATCGTTTTCGATGTGACGCTGCCCCCCCCGGATTTCGCAAGGATTAGCATGAATTTATTTTCGTCCCACTTTATGTGGGCCTTTAATGTTCCACGTGGAACCACGTGGAACTGCCTGTTTGGATAAATCCCGGAAGGCATCGATATCCTGGATCTCTGCTGTTCCGGCGTACGAGTACGAGCCGGTTGTGTGGAGCTACTTGGAGCTACTCAGCACAGTGCAGCAGAGTGCGCCCGAAATACCATGTCTT

Full Affymetrix probeset data:

Annotations for 1624186_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720