FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624187_at:

>probe:Drosophila_2:1624187_at:27:461; Interrogation_Position=2945; Antisense; GATTTGAGGATCCTTGGCCTGCAGC
>probe:Drosophila_2:1624187_at:163:57; Interrogation_Position=2997; Antisense; ATGACGCCCGCAATTTGGTGCGCAA
>probe:Drosophila_2:1624187_at:3:225; Interrogation_Position=3020; Antisense; AAGGATTTCTTTCGTCGCACGCATA
>probe:Drosophila_2:1624187_at:382:355; Interrogation_Position=3093; Antisense; GCACGATCTTCGTTCGCAACATATA
>probe:Drosophila_2:1624187_at:354:649; Interrogation_Position=3141; Antisense; TCAGCTTCGTCATCAATCGCTTTCG
>probe:Drosophila_2:1624187_at:158:45; Interrogation_Position=3156; Antisense; ATCGCTTTCGCTCGCATCAGGATGA
>probe:Drosophila_2:1624187_at:415:35; Interrogation_Position=3171; Antisense; ATCAGGATGAGTGCTGCCAGCTCAA
>probe:Drosophila_2:1624187_at:483:313; Interrogation_Position=3186; Antisense; GCCAGCTCAAGCTCGATGCGATGGT
>probe:Drosophila_2:1624187_at:710:511; Interrogation_Position=3209; Antisense; GTGATGAGCTCCAAGGACTGTCCAT
>probe:Drosophila_2:1624187_at:315:557; Interrogation_Position=3223; Antisense; GGACTGTCCATATATGTAGCTTCTA
>probe:Drosophila_2:1624187_at:288:487; Interrogation_Position=3238; Antisense; GTAGCTTCTAGTTTCATCACTGTCC
>probe:Drosophila_2:1624187_at:239:581; Interrogation_Position=3272; Antisense; TGGCCAGCATTCTCTTGCGAAAGAA
>probe:Drosophila_2:1624187_at:663:341; Interrogation_Position=3404; Antisense; GCTTTAATCGTTCGACATCATCGGA
>probe:Drosophila_2:1624187_at:18:97; Interrogation_Position=3451; Antisense; AGATCTTGCCATGTGCTATTCTTAA

Paste this into a BLAST search page for me
GATTTGAGGATCCTTGGCCTGCAGCATGACGCCCGCAATTTGGTGCGCAAAAGGATTTCTTTCGTCGCACGCATAGCACGATCTTCGTTCGCAACATATATCAGCTTCGTCATCAATCGCTTTCGATCGCTTTCGCTCGCATCAGGATGAATCAGGATGAGTGCTGCCAGCTCAAGCCAGCTCAAGCTCGATGCGATGGTGTGATGAGCTCCAAGGACTGTCCATGGACTGTCCATATATGTAGCTTCTAGTAGCTTCTAGTTTCATCACTGTCCTGGCCAGCATTCTCTTGCGAAAGAAGCTTTAATCGTTCGACATCATCGGAAGATCTTGCCATGTGCTATTCTTAA

Full Affymetrix probeset data:

Annotations for 1624187_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720