Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624188_at:

>probe:Drosophila_2:1624188_at:167:131; Interrogation_Position=1214; Antisense; ACCTAACTGATGATGCGTCGTGCAA
>probe:Drosophila_2:1624188_at:589:207; Interrogation_Position=1291; Antisense; AAGCTGCTCTGGATGTGGCCGACAT
>probe:Drosophila_2:1624188_at:432:401; Interrogation_Position=1311; Antisense; GACATCGGTGGACTTGGACTACTTT
>probe:Drosophila_2:1624188_at:56:711; Interrogation_Position=1334; Antisense; TTAATCAGCTGCTAGCCATGCACGA
>probe:Drosophila_2:1624188_at:683:53; Interrogation_Position=1351; Antisense; ATGCACGACATCCAGCGAGTTTTGA
>probe:Drosophila_2:1624188_at:563:295; Interrogation_Position=1366; Antisense; CGAGTTTTGAGCATCGGCTGCGGCA
>probe:Drosophila_2:1624188_at:698:575; Interrogation_Position=1422; Antisense; TGGAGGTCGGAAAGTCCCCATGTTT
>probe:Drosophila_2:1624188_at:602:691; Interrogation_Position=1444; Antisense; TTTGGCTTGGAGGTCGATCGCAACT
>probe:Drosophila_2:1624188_at:350:521; Interrogation_Position=1470; Antisense; GTGGCAGAGCAAGTACTCCGTTCGA
>probe:Drosophila_2:1624188_at:360:167; Interrogation_Position=1555; Antisense; AAATGCTGCAGTGACGTTCATCCGT
>probe:Drosophila_2:1624188_at:543:337; Interrogation_Position=1587; Antisense; GCTCTTCTGCTACTTCAACAATCGA
>probe:Drosophila_2:1624188_at:113:437; Interrogation_Position=1610; Antisense; GAGGAGCTTTTCTGGACTATCTAAA
>probe:Drosophila_2:1624188_at:525:687; Interrogation_Position=1656; Antisense; TATATTGATTGGACCATTGCCCGCC
>probe:Drosophila_2:1624188_at:663:421; Interrogation_Position=1745; Antisense; GAGAACGCCTTAACTGGACTGACCA

Paste this into a BLAST search page for me
ACCTAACTGATGATGCGTCGTGCAAAAGCTGCTCTGGATGTGGCCGACATGACATCGGTGGACTTGGACTACTTTTTAATCAGCTGCTAGCCATGCACGAATGCACGACATCCAGCGAGTTTTGACGAGTTTTGAGCATCGGCTGCGGCATGGAGGTCGGAAAGTCCCCATGTTTTTTGGCTTGGAGGTCGATCGCAACTGTGGCAGAGCAAGTACTCCGTTCGAAAATGCTGCAGTGACGTTCATCCGTGCTCTTCTGCTACTTCAACAATCGAGAGGAGCTTTTCTGGACTATCTAAATATATTGATTGGACCATTGCCCGCCGAGAACGCCTTAACTGGACTGACCA

Full Affymetrix probeset data:

Annotations for 1624188_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime