Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624189_at:

>probe:Drosophila_2:1624189_at:385:29; Interrogation_Position=2558; Antisense; ATACTTAGCCCATATCGATCACTTT
>probe:Drosophila_2:1624189_at:249:685; Interrogation_Position=2570; Antisense; TATCGATCACTTTATTTTAGCTCTT
>probe:Drosophila_2:1624189_at:388:693; Interrogation_Position=2585; Antisense; TTTAGCTCTTAAACAACCTCATATG
>probe:Drosophila_2:1624189_at:326:269; Interrogation_Position=2704; Antisense; CATGAGATTCTCTGCCCAATTTGAT
>probe:Drosophila_2:1624189_at:463:625; Interrogation_Position=2716; Antisense; TGCCCAATTTGATTCCGCAGGAAGG
>probe:Drosophila_2:1624189_at:553:377; Interrogation_Position=2740; Antisense; GAAGCTGTGTACTTTGCTCACAAGC
>probe:Drosophila_2:1624189_at:461:15; Interrogation_Position=2792; Antisense; ATATATTACCCCTTGTGTACAAATT
>probe:Drosophila_2:1624189_at:698:459; Interrogation_Position=2824; Antisense; GATTTAATCCAATTACCCGGCGCGC
>probe:Drosophila_2:1624189_at:55:299; Interrogation_Position=2846; Antisense; CGCTTTTGACCATCTGTGTTCAGCA
>probe:Drosophila_2:1624189_at:333:603; Interrogation_Position=2862; Antisense; TGTTCAGCATTAGAGCGTTGGCAGT
>probe:Drosophila_2:1624189_at:234:479; Interrogation_Position=2920; Antisense; GTTTAAGACACCACAAATTCGATTG
>probe:Drosophila_2:1624189_at:643:401; Interrogation_Position=2945; Antisense; GACATAGTTTAGTTATTCGGTGTAA
>probe:Drosophila_2:1624189_at:610:247; Interrogation_Position=2973; Antisense; AATTGAGTATACCAGCCCACACGAG
>probe:Drosophila_2:1624189_at:417:141; Interrogation_Position=3008; Antisense; ACGGAAGTCATAGCGCGATAAGTTG

Paste this into a BLAST search page for me
ATACTTAGCCCATATCGATCACTTTTATCGATCACTTTATTTTAGCTCTTTTTAGCTCTTAAACAACCTCATATGCATGAGATTCTCTGCCCAATTTGATTGCCCAATTTGATTCCGCAGGAAGGGAAGCTGTGTACTTTGCTCACAAGCATATATTACCCCTTGTGTACAAATTGATTTAATCCAATTACCCGGCGCGCCGCTTTTGACCATCTGTGTTCAGCATGTTCAGCATTAGAGCGTTGGCAGTGTTTAAGACACCACAAATTCGATTGGACATAGTTTAGTTATTCGGTGTAAAATTGAGTATACCAGCCCACACGAGACGGAAGTCATAGCGCGATAAGTTG

Full Affymetrix probeset data:

Annotations for 1624189_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime