FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624190_at:

>probe:Drosophila_2:1624190_at:131:177; Interrogation_Position=2099; Antisense; AAACTTAGTCTAAATAGGGCTGCGT
>probe:Drosophila_2:1624190_at:65:679; Interrogation_Position=2113; Antisense; TAGGGCTGCGTATAGTGGAATGTTT
>probe:Drosophila_2:1624190_at:490:561; Interrogation_Position=2129; Antisense; GGAATGTTTACTTGGCTTTTTGATG
>probe:Drosophila_2:1624190_at:246:567; Interrogation_Position=2165; Antisense; GGCAAACAACTTTTGTAATTTGGCT
>probe:Drosophila_2:1624190_at:680:569; Interrogation_Position=2186; Antisense; GGCTTAACAATGAAATCCAGTGATT
>probe:Drosophila_2:1624190_at:38:187; Interrogation_Position=2219; Antisense; AACAACCAAAACGTATCACAGAGAT
>probe:Drosophila_2:1624190_at:278:11; Interrogation_Position=2346; Antisense; ATTACCCTAGTATCAATTTAGACAC
>probe:Drosophila_2:1624190_at:647:99; Interrogation_Position=2413; Antisense; AGAGCAATGGGCACTCAATTCCTAC
>probe:Drosophila_2:1624190_at:712:525; Interrogation_Position=2421; Antisense; GGGCACTCAATTCCTACTCATAAGT
>probe:Drosophila_2:1624190_at:166:667; Interrogation_Position=2435; Antisense; TACTCATAAGTTTCCTTAGGCATAA
>probe:Drosophila_2:1624190_at:412:489; Interrogation_Position=2500; Antisense; GTACTATACTTTATGTCCTTATTAT
>probe:Drosophila_2:1624190_at:361:661; Interrogation_Position=2526; Antisense; TAAATGAGTTATGTTCGTTTTCTTT
>probe:Drosophila_2:1624190_at:557:719; Interrogation_Position=2551; Antisense; TTCCGAAACGAAGCCCAGTTCATCG
>probe:Drosophila_2:1624190_at:707:319; Interrogation_Position=2563; Antisense; GCCCAGTTCATCGATAGATACGTTA

Paste this into a BLAST search page for me
AAACTTAGTCTAAATAGGGCTGCGTTAGGGCTGCGTATAGTGGAATGTTTGGAATGTTTACTTGGCTTTTTGATGGGCAAACAACTTTTGTAATTTGGCTGGCTTAACAATGAAATCCAGTGATTAACAACCAAAACGTATCACAGAGATATTACCCTAGTATCAATTTAGACACAGAGCAATGGGCACTCAATTCCTACGGGCACTCAATTCCTACTCATAAGTTACTCATAAGTTTCCTTAGGCATAAGTACTATACTTTATGTCCTTATTATTAAATGAGTTATGTTCGTTTTCTTTTTCCGAAACGAAGCCCAGTTCATCGGCCCAGTTCATCGATAGATACGTTA

Full Affymetrix probeset data:

Annotations for 1624190_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720