Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624191_at:

>probe:Drosophila_2:1624191_at:642:483; Interrogation_Position=6930; Antisense; GTATGAAGCCGCCAAGCGAATTTTG
>probe:Drosophila_2:1624191_at:14:445; Interrogation_Position=6967; Antisense; GATGATTTGGATGCTCTGCGGGAAA
>probe:Drosophila_2:1624191_at:442:337; Interrogation_Position=6979; Antisense; GCTCTGCGGGAAAAACTCGCGAAAT
>probe:Drosophila_2:1624191_at:213:273; Interrogation_Position=7054; Antisense; CATATGTGTATGTGTTTGGGCTTAG
>probe:Drosophila_2:1624191_at:633:339; Interrogation_Position=7073; Antisense; GCTTAGGTTAATTTTGGGTGTCATC
>probe:Drosophila_2:1624191_at:290:429; Interrogation_Position=7103; Antisense; GAGTTCATACAGAGTTCCGAGCTAT
>probe:Drosophila_2:1624191_at:703:513; Interrogation_Position=7147; Antisense; GTGTTGTACTTAAACGTCTCATCCT
>probe:Drosophila_2:1624191_at:455:177; Interrogation_Position=7158; Antisense; AAACGTCTCATCCTTGTTAGGTATA
>probe:Drosophila_2:1624191_at:175:159; Interrogation_Position=7248; Antisense; ACACATTGTCTTCATAACGCGGCTT
>probe:Drosophila_2:1624191_at:222:661; Interrogation_Position=7262; Antisense; TAACGCGGCTTTATTGTAATGTCAA
>probe:Drosophila_2:1624191_at:73:371; Interrogation_Position=7316; Antisense; GAATGTCTACTTATATTGCTTATGT
>probe:Drosophila_2:1624191_at:447:495; Interrogation_Position=7372; Antisense; GTCTTAACCAAATCGCATTAGCCAT
>probe:Drosophila_2:1624191_at:205:55; Interrogation_Position=7418; Antisense; ATGCAATCTATTGCACTCCGCTTGC
>probe:Drosophila_2:1624191_at:284:633; Interrogation_Position=7434; Antisense; TCCGCTTGCGCCAAAATTTGGGCGA

Paste this into a BLAST search page for me
GTATGAAGCCGCCAAGCGAATTTTGGATGATTTGGATGCTCTGCGGGAAAGCTCTGCGGGAAAAACTCGCGAAATCATATGTGTATGTGTTTGGGCTTAGGCTTAGGTTAATTTTGGGTGTCATCGAGTTCATACAGAGTTCCGAGCTATGTGTTGTACTTAAACGTCTCATCCTAAACGTCTCATCCTTGTTAGGTATAACACATTGTCTTCATAACGCGGCTTTAACGCGGCTTTATTGTAATGTCAAGAATGTCTACTTATATTGCTTATGTGTCTTAACCAAATCGCATTAGCCATATGCAATCTATTGCACTCCGCTTGCTCCGCTTGCGCCAAAATTTGGGCGA

Full Affymetrix probeset data:

Annotations for 1624191_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime