Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624192_at:

>probe:Drosophila_2:1624192_at:132:531; Interrogation_Position=1564; Antisense; GGGTATGCAATAGCCTGATCTGGGA
>probe:Drosophila_2:1624192_at:310:605; Interrogation_Position=1579; Antisense; TGATCTGGGAGTTTCTCAGCACCAT
>probe:Drosophila_2:1624192_at:477:51; Interrogation_Position=1602; Antisense; ATGCTGATGGCCAAGTCACACGCGG
>probe:Drosophila_2:1624192_at:403:157; Interrogation_Position=1619; Antisense; ACACGCGGTGCTCCACAAGTACGAG
>probe:Drosophila_2:1624192_at:179:125; Interrogation_Position=1642; Antisense; AGCGCCAAACGGAGGTGCTCAACTC
>probe:Drosophila_2:1624192_at:549:195; Interrogation_Position=1702; Antisense; AACTGTGCACCTTCATCGAACTGTG
>probe:Drosophila_2:1624192_at:490:721; Interrogation_Position=1755; Antisense; TTGCGCAAGATGTCCCAACTGGTGA
>probe:Drosophila_2:1624192_at:523:165; Interrogation_Position=1801; Antisense; AAATCTCCAACAGGTCCAGTTTCCT
>probe:Drosophila_2:1624192_at:221:635; Interrogation_Position=1842; Antisense; TCGCCCAACTTCTCGGAATTCAAAA
>probe:Drosophila_2:1624192_at:139:101; Interrogation_Position=1871; Antisense; AGAGTATGGTCATTTGGCCGCCTAA
>probe:Drosophila_2:1624192_at:353:25; Interrogation_Position=1925; Antisense; ATAGGCAGTGCCTTCTATTCGAACT
>probe:Drosophila_2:1624192_at:224:383; Interrogation_Position=1945; Antisense; GAACTGTTGCCTTTGGTCGGGCCAA
>probe:Drosophila_2:1624192_at:192:501; Interrogation_Position=1960; Antisense; GTCGGGCCAAGTGTCAGCCACAAAA
>probe:Drosophila_2:1624192_at:236:473; Interrogation_Position=2031; Antisense; GTTCAGAGCCAGATGTCTGTAGCAT

Paste this into a BLAST search page for me
GGGTATGCAATAGCCTGATCTGGGATGATCTGGGAGTTTCTCAGCACCATATGCTGATGGCCAAGTCACACGCGGACACGCGGTGCTCCACAAGTACGAGAGCGCCAAACGGAGGTGCTCAACTCAACTGTGCACCTTCATCGAACTGTGTTGCGCAAGATGTCCCAACTGGTGAAAATCTCCAACAGGTCCAGTTTCCTTCGCCCAACTTCTCGGAATTCAAAAAGAGTATGGTCATTTGGCCGCCTAAATAGGCAGTGCCTTCTATTCGAACTGAACTGTTGCCTTTGGTCGGGCCAAGTCGGGCCAAGTGTCAGCCACAAAAGTTCAGAGCCAGATGTCTGTAGCAT

Full Affymetrix probeset data:

Annotations for 1624192_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime