Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624194_a_at:

>probe:Drosophila_2:1624194_a_at:176:653; Interrogation_Position=141; Antisense; TAACATGGAACCTTGGTCCTTTGCC
>probe:Drosophila_2:1624194_a_at:332:695; Interrogation_Position=160; Antisense; TTTGCCCTCAATTTCGATGACAGCG
>probe:Drosophila_2:1624194_a_at:285:31; Interrogation_Position=197; Antisense; ATAACGAGAGCCACTCTTCGACCAG
>probe:Drosophila_2:1624194_a_at:67:117; Interrogation_Position=247; Antisense; AGCATAGACACCAGCTCCGTGGAGA
>probe:Drosophila_2:1624194_a_at:663:493; Interrogation_Position=286; Antisense; GTAATTGAGAGCCAGTCTGTCCCTG
>probe:Drosophila_2:1624194_a_at:670:675; Interrogation_Position=32; Antisense; TAGCTCACACCTTATGTTCCTATAA
>probe:Drosophila_2:1624194_a_at:357:27; Interrogation_Position=415; Antisense; ATAGCCGATGCCTTTGTTAACGACA
>probe:Drosophila_2:1624194_a_at:290:475; Interrogation_Position=430; Antisense; GTTAACGACATATCCATGCGCATAG
>probe:Drosophila_2:1624194_a_at:191:625; Interrogation_Position=446; Antisense; TGCGCATAGTTAAGTTGGCCAAGTA
>probe:Drosophila_2:1624194_a_at:14:673; Interrogation_Position=486; Antisense; TAGCGTGCTGGACCTGAAGTTCATC
>probe:Drosophila_2:1624194_a_at:281:217; Interrogation_Position=502; Antisense; AAGTTCATCCTCAAGCGGGAGTTCA
>probe:Drosophila_2:1624194_a_at:234:551; Interrogation_Position=519; Antisense; GGAGTTCAACATGGAGTTCCCAATT
>probe:Drosophila_2:1624194_a_at:338:17; Interrogation_Position=56; Antisense; ATTTCCAACCAGTTCAAGCCACTTT
>probe:Drosophila_2:1624194_a_at:333:203; Interrogation_Position=71; Antisense; AAGCCACTTTCTTACCTAGTGCATG

Paste this into a BLAST search page for me
TAACATGGAACCTTGGTCCTTTGCCTTTGCCCTCAATTTCGATGACAGCGATAACGAGAGCCACTCTTCGACCAGAGCATAGACACCAGCTCCGTGGAGAGTAATTGAGAGCCAGTCTGTCCCTGTAGCTCACACCTTATGTTCCTATAAATAGCCGATGCCTTTGTTAACGACAGTTAACGACATATCCATGCGCATAGTGCGCATAGTTAAGTTGGCCAAGTATAGCGTGCTGGACCTGAAGTTCATCAAGTTCATCCTCAAGCGGGAGTTCAGGAGTTCAACATGGAGTTCCCAATTATTTCCAACCAGTTCAAGCCACTTTAAGCCACTTTCTTACCTAGTGCATG

Full Affymetrix probeset data:

Annotations for 1624194_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime