FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624195_at:

>probe:Drosophila_2:1624195_at:202:297; Interrogation_Position=1057; Antisense; CGCTACTACGATGACTCCAACAATG
>probe:Drosophila_2:1624195_at:521:327; Interrogation_Position=1088; Antisense; GCGATTACTCGCTAAAACCCAAACA
>probe:Drosophila_2:1624195_at:433:189; Interrogation_Position=1109; Antisense; AACAGGATGCGGAATTCTCGCCCAG
>probe:Drosophila_2:1624195_at:81:117; Interrogation_Position=1154; Antisense; AGCATAGCTATCTCCACAGCGAGGA
>probe:Drosophila_2:1624195_at:557:283; Interrogation_Position=1216; Antisense; CTGCGCATCCATCGAATCTGAACTG
>probe:Drosophila_2:1624195_at:305:39; Interrogation_Position=1231; Antisense; ATCTGAACTGGCCAATCGGTTCGCC
>probe:Drosophila_2:1624195_at:296:273; Interrogation_Position=1272; Antisense; CTTCTAGTCATTGCGCTGTTTCCCA
>probe:Drosophila_2:1624195_at:136:275; Interrogation_Position=1300; Antisense; CTTGTCACCACACCTAGATTACTAT
>probe:Drosophila_2:1624195_at:335:109; Interrogation_Position=776; Antisense; AGAAGGCGTACTCGAACTCCTCGGA
>probe:Drosophila_2:1624195_at:91:195; Interrogation_Position=790; Antisense; AACTCCTCGGATCGTTTCAAGCACA
>probe:Drosophila_2:1624195_at:374:157; Interrogation_Position=812; Antisense; ACACGCGCACCCATTCGATGGAGAA
>probe:Drosophila_2:1624195_at:155:667; Interrogation_Position=841; Antisense; TACATGTGCAAAGTGGCCGGCTGCC
>probe:Drosophila_2:1624195_at:381:335; Interrogation_Position=891; Antisense; GCTGCGAAAGCACGTCAAGACCTTC
>probe:Drosophila_2:1624195_at:228:589; Interrogation_Position=977; Antisense; TGGAGGCCAGCAGCGAATCAGCGTT

Paste this into a BLAST search page for me
CGCTACTACGATGACTCCAACAATGGCGATTACTCGCTAAAACCCAAACAAACAGGATGCGGAATTCTCGCCCAGAGCATAGCTATCTCCACAGCGAGGACTGCGCATCCATCGAATCTGAACTGATCTGAACTGGCCAATCGGTTCGCCCTTCTAGTCATTGCGCTGTTTCCCACTTGTCACCACACCTAGATTACTATAGAAGGCGTACTCGAACTCCTCGGAAACTCCTCGGATCGTTTCAAGCACAACACGCGCACCCATTCGATGGAGAATACATGTGCAAAGTGGCCGGCTGCCGCTGCGAAAGCACGTCAAGACCTTCTGGAGGCCAGCAGCGAATCAGCGTT

Full Affymetrix probeset data:

Annotations for 1624195_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720