FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624198_at:

>probe:Drosophila_2:1624198_at:53:321; Interrogation_Position=2405; Antisense; GCCCCAATGGCGTGCAGTACGACAA
>probe:Drosophila_2:1624198_at:694:487; Interrogation_Position=2421; Antisense; GTACGACAAGGTCATTGCCATCTCC
>probe:Drosophila_2:1624198_at:542:471; Interrogation_Position=2463; Antisense; GTTCACCAGAACTAACGCGTTTTTG
>probe:Drosophila_2:1624198_at:121:77; Interrogation_Position=2510; Antisense; AGGATGTGATCTCTAGGACCCACTT
>probe:Drosophila_2:1624198_at:595:713; Interrogation_Position=2533; Antisense; TTCTTTCCCAGTAGCATTGCCGGAG
>probe:Drosophila_2:1624198_at:69:73; Interrogation_Position=2570; Antisense; AGGACCCCGGGCTTGAGTTCGAGAT
>probe:Drosophila_2:1624198_at:497:721; Interrogation_Position=2582; Antisense; TTGAGTTCGAGATTGCCTCCCGTAC
>probe:Drosophila_2:1624198_at:326:487; Interrogation_Position=2603; Antisense; GTACCTGTCTTAACACCACAAACGT
>probe:Drosophila_2:1624198_at:324:633; Interrogation_Position=2630; Antisense; TCCGCAACAGCGTCAGCATTAGCAT
>probe:Drosophila_2:1624198_at:405:707; Interrogation_Position=2648; Antisense; TTAGCATACAGGTGAAGCGCCCCGC
>probe:Drosophila_2:1624198_at:190:483; Interrogation_Position=2674; Antisense; GTATTTGTATACCTAGAGCTGCTCA
>probe:Drosophila_2:1624198_at:724:607; Interrogation_Position=2742; Antisense; TGAGCCAATGCATGTCGTCTACCTA
>probe:Drosophila_2:1624198_at:6:509; Interrogation_Position=2818; Antisense; GTGCTGACCGTCAACGACTTTATGA
>probe:Drosophila_2:1624198_at:36:489; Interrogation_Position=2847; Antisense; GTACGGAACGTCTTCATTGACAACT

Paste this into a BLAST search page for me
GCCCCAATGGCGTGCAGTACGACAAGTACGACAAGGTCATTGCCATCTCCGTTCACCAGAACTAACGCGTTTTTGAGGATGTGATCTCTAGGACCCACTTTTCTTTCCCAGTAGCATTGCCGGAGAGGACCCCGGGCTTGAGTTCGAGATTTGAGTTCGAGATTGCCTCCCGTACGTACCTGTCTTAACACCACAAACGTTCCGCAACAGCGTCAGCATTAGCATTTAGCATACAGGTGAAGCGCCCCGCGTATTTGTATACCTAGAGCTGCTCATGAGCCAATGCATGTCGTCTACCTAGTGCTGACCGTCAACGACTTTATGAGTACGGAACGTCTTCATTGACAACT

Full Affymetrix probeset data:

Annotations for 1624198_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720