Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624199_at:

>probe:Drosophila_2:1624199_at:677:107; Interrogation_Position=2855; Antisense; AGAACTGCCGCTTTATACTGCTATT
>probe:Drosophila_2:1624199_at:480:13; Interrogation_Position=2902; Antisense; ATTCAAGCCGCGACAATTGCCGGGC
>probe:Drosophila_2:1624199_at:96:319; Interrogation_Position=2920; Antisense; GCCGGGCCATTTCGCATATTTACAA
>probe:Drosophila_2:1624199_at:429:689; Interrogation_Position=2936; Antisense; TATTTACAATGCCTCGCAGGGTGAT
>probe:Drosophila_2:1624199_at:566:349; Interrogation_Position=2951; Antisense; GCAGGGTGATTCCAACTCCAAATTC
>probe:Drosophila_2:1624199_at:128:101; Interrogation_Position=2981; Antisense; AGAGCAGTTTGCCTTTGTCGTTTTC
>probe:Drosophila_2:1624199_at:496:475; Interrogation_Position=3000; Antisense; GTTTTCAATTTGTACCTACTCGCAA
>probe:Drosophila_2:1624199_at:374:341; Interrogation_Position=3060; Antisense; GCTTTCGCCAGTCGCACGGAATTAA
>probe:Drosophila_2:1624199_at:313:663; Interrogation_Position=3082; Antisense; TAAATTTCGGGCGAGCTCTTTTTAT
>probe:Drosophila_2:1624199_at:471:115; Interrogation_Position=3095; Antisense; AGCTCTTTTTATCCCCAATTGTGTG
>probe:Drosophila_2:1624199_at:137:497; Interrogation_Position=3127; Antisense; GTCAGCTACAAACTCGTTTTCCTGG
>probe:Drosophila_2:1624199_at:670:523; Interrogation_Position=3150; Antisense; GGGCCCACCAGAACACAAGAACAAT
>probe:Drosophila_2:1624199_at:59:185; Interrogation_Position=3169; Antisense; AACAATAATTTGCTCGACTCGGAAA
>probe:Drosophila_2:1624199_at:407:633; Interrogation_Position=3203; Antisense; TCCCACGGCCGATGGAGTTCTATAA

Paste this into a BLAST search page for me
AGAACTGCCGCTTTATACTGCTATTATTCAAGCCGCGACAATTGCCGGGCGCCGGGCCATTTCGCATATTTACAATATTTACAATGCCTCGCAGGGTGATGCAGGGTGATTCCAACTCCAAATTCAGAGCAGTTTGCCTTTGTCGTTTTCGTTTTCAATTTGTACCTACTCGCAAGCTTTCGCCAGTCGCACGGAATTAATAAATTTCGGGCGAGCTCTTTTTATAGCTCTTTTTATCCCCAATTGTGTGGTCAGCTACAAACTCGTTTTCCTGGGGGCCCACCAGAACACAAGAACAATAACAATAATTTGCTCGACTCGGAAATCCCACGGCCGATGGAGTTCTATAA

Full Affymetrix probeset data:

Annotations for 1624199_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime