Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624200_at:

>probe:Drosophila_2:1624200_at:183:523; Interrogation_Position=1639; Antisense; GGGCACCTTAAACAGAGCTTCATCT
>probe:Drosophila_2:1624200_at:125:465; Interrogation_Position=1671; Antisense; GATTGATCCACGCATTTCTCGGAAT
>probe:Drosophila_2:1624200_at:673:727; Interrogation_Position=1734; Antisense; TTGGCAGCGTTTTCTGGACTCCATT
>probe:Drosophila_2:1624200_at:249:491; Interrogation_Position=1775; Antisense; GTAAATGTTCGCGACCGTACGCTCA
>probe:Drosophila_2:1624200_at:499:379; Interrogation_Position=1940; Antisense; GAAGCCGTAAGCTGGAGCGCATCCT
>probe:Drosophila_2:1624200_at:359:323; Interrogation_Position=1956; Antisense; GCGCATCCTGGACATTTGGCAACAT
>probe:Drosophila_2:1624200_at:34:433; Interrogation_Position=1988; Antisense; GAGTCGTATGTCTTCATGTCTTTCA
>probe:Drosophila_2:1624200_at:122:447; Interrogation_Position=2029; Antisense; GATGCATACACACGCGAAGCTTCCA
>probe:Drosophila_2:1624200_at:676:377; Interrogation_Position=2044; Antisense; GAAGCTTCCATTATAGACGCTCTGG
>probe:Drosophila_2:1624200_at:634:285; Interrogation_Position=2065; Antisense; CTGGGCTTGAATCACCTTACCAATA
>probe:Drosophila_2:1624200_at:54:663; Interrogation_Position=2090; Antisense; TAAAGCGCGGCGACTACTATGGGCC
>probe:Drosophila_2:1624200_at:527:317; Interrogation_Position=2112; Antisense; GCCGGCTCAGTCTTGGACCATGAAA
>probe:Drosophila_2:1624200_at:677:241; Interrogation_Position=2154; Antisense; AATAGCGCTGCTTTTCAAGGCCATG
>probe:Drosophila_2:1624200_at:660:269; Interrogation_Position=2175; Antisense; CATGCACATCTATCTGGCGGAGGGA

Paste this into a BLAST search page for me
GGGCACCTTAAACAGAGCTTCATCTGATTGATCCACGCATTTCTCGGAATTTGGCAGCGTTTTCTGGACTCCATTGTAAATGTTCGCGACCGTACGCTCAGAAGCCGTAAGCTGGAGCGCATCCTGCGCATCCTGGACATTTGGCAACATGAGTCGTATGTCTTCATGTCTTTCAGATGCATACACACGCGAAGCTTCCAGAAGCTTCCATTATAGACGCTCTGGCTGGGCTTGAATCACCTTACCAATATAAAGCGCGGCGACTACTATGGGCCGCCGGCTCAGTCTTGGACCATGAAAAATAGCGCTGCTTTTCAAGGCCATGCATGCACATCTATCTGGCGGAGGGA

Full Affymetrix probeset data:

Annotations for 1624200_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime