FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624201_at:

>probe:Drosophila_2:1624201_at:50:697; Interrogation_Position=1038; Antisense; TTTCAGTTTGGTTATGGCTCGGTAC
>probe:Drosophila_2:1624201_at:42:539; Interrogation_Position=1058; Antisense; GGTACCTGCTGTGGCATCCAAACGA
>probe:Drosophila_2:1624201_at:80:627; Interrogation_Position=1109; Antisense; TGCCTGTTTGTTCTCAGCATGTCAA
>probe:Drosophila_2:1624201_at:484:553; Interrogation_Position=577; Antisense; GGAGCCTGCTGATGAGCCTATGTAT
>probe:Drosophila_2:1624201_at:415:59; Interrogation_Position=596; Antisense; ATGTATGTTTTCAGCGGTCCCAAGA
>probe:Drosophila_2:1624201_at:730:585; Interrogation_Position=642; Antisense; TGGAGAAGGCGTTCTTTACAACCAA
>probe:Drosophila_2:1624201_at:664:77; Interrogation_Position=675; Antisense; AGGTTACACTTCCACTCGGCTTAGT
>probe:Drosophila_2:1624201_at:58:599; Interrogation_Position=699; Antisense; TGTCCCATAAGAATTGTGGCCCCTC
>probe:Drosophila_2:1624201_at:16:225; Interrogation_Position=767; Antisense; AAGGATCCCGATCTTCGATTCGAAA
>probe:Drosophila_2:1624201_at:458:27; Interrogation_Position=806; Antisense; ATACCAGTACACAATCCGCTTGTCA
>probe:Drosophila_2:1624201_at:683:723; Interrogation_Position=825; Antisense; TTGTCATTGTTCACGCGGTTACCAA
>probe:Drosophila_2:1624201_at:205:369; Interrogation_Position=868; Antisense; GAATGTTTTGGCCAACACCTTGTTT
>probe:Drosophila_2:1624201_at:465:93; Interrogation_Position=900; Antisense; AGTTCCAGGTGTCCGTGCAGACGTA
>probe:Drosophila_2:1624201_at:720:527; Interrogation_Position=982; Antisense; TGGGTCGTTCCATAAGTCGGCGTAT

Paste this into a BLAST search page for me
TTTCAGTTTGGTTATGGCTCGGTACGGTACCTGCTGTGGCATCCAAACGATGCCTGTTTGTTCTCAGCATGTCAAGGAGCCTGCTGATGAGCCTATGTATATGTATGTTTTCAGCGGTCCCAAGATGGAGAAGGCGTTCTTTACAACCAAAGGTTACACTTCCACTCGGCTTAGTTGTCCCATAAGAATTGTGGCCCCTCAAGGATCCCGATCTTCGATTCGAAAATACCAGTACACAATCCGCTTGTCATTGTCATTGTTCACGCGGTTACCAAGAATGTTTTGGCCAACACCTTGTTTAGTTCCAGGTGTCCGTGCAGACGTATGGGTCGTTCCATAAGTCGGCGTAT

Full Affymetrix probeset data:

Annotations for 1624201_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720