FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624204_at:

>probe:Drosophila_2:1624204_at:695:293; Interrogation_Position=1029; Antisense; CGATGATCCTCGTATAGCCCTGAAG
>probe:Drosophila_2:1624204_at:387:685; Interrogation_Position=1041; Antisense; TATAGCCCTGAAGCCCGATGATATC
>probe:Drosophila_2:1624204_at:334:37; Interrogation_Position=1063; Antisense; ATCATACATGTGACTCGCATCCAGG
>probe:Drosophila_2:1624204_at:306:77; Interrogation_Position=1085; Antisense; AGGAGTACTGGCTTTATGGCGAAAT
>probe:Drosophila_2:1624204_at:55:635; Interrogation_Position=1173; Antisense; TCCCAGCTGTTGTGCCATCGAAATA
>probe:Drosophila_2:1624204_at:670:605; Interrogation_Position=1307; Antisense; TGAGGGATTTTTCCTGCAATGATGG
>probe:Drosophila_2:1624204_at:214:567; Interrogation_Position=1338; Antisense; GGCAAAGCGCCTGCATATTGAGTAA
>probe:Drosophila_2:1624204_at:99:221; Interrogation_Position=1362; Antisense; AAGTGTATGTCTCTGGGCGACTTTA
>probe:Drosophila_2:1624204_at:473:485; Interrogation_Position=1392; Antisense; GTAGAGAAATCCCTGGCTTTCGCCG
>probe:Drosophila_2:1624204_at:203:395; Interrogation_Position=1421; Antisense; GAAATTGCTTTGGTCAACCACCGCA
>probe:Drosophila_2:1624204_at:93:495; Interrogation_Position=1433; Antisense; GTCAACCACCGCATTAATCTCTTAA
>probe:Drosophila_2:1624204_at:352:455; Interrogation_Position=922; Antisense; GATAAAAGGGCTCGCACTCGGGTCT
>probe:Drosophila_2:1624204_at:521:537; Interrogation_Position=942; Antisense; GGTCTTTAGATGTATTCGCCCTGCC
>probe:Drosophila_2:1624204_at:62:225; Interrogation_Position=995; Antisense; AAGGACTGTGGGTATCCCTCCAGAT

Paste this into a BLAST search page for me
CGATGATCCTCGTATAGCCCTGAAGTATAGCCCTGAAGCCCGATGATATCATCATACATGTGACTCGCATCCAGGAGGAGTACTGGCTTTATGGCGAAATTCCCAGCTGTTGTGCCATCGAAATATGAGGGATTTTTCCTGCAATGATGGGGCAAAGCGCCTGCATATTGAGTAAAAGTGTATGTCTCTGGGCGACTTTAGTAGAGAAATCCCTGGCTTTCGCCGGAAATTGCTTTGGTCAACCACCGCAGTCAACCACCGCATTAATCTCTTAAGATAAAAGGGCTCGCACTCGGGTCTGGTCTTTAGATGTATTCGCCCTGCCAAGGACTGTGGGTATCCCTCCAGAT

Full Affymetrix probeset data:

Annotations for 1624204_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720