FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624205_at:

>probe:Drosophila_2:1624205_at:41:387; Interrogation_Position=1094; Antisense; GAACAACTTTAGACTCGGCTGCGGG
>probe:Drosophila_2:1624205_at:508:639; Interrogation_Position=1126; Antisense; TCGGCTAAGCCGGATCTTTGGACGG
>probe:Drosophila_2:1624205_at:257:691; Interrogation_Position=1142; Antisense; TTTGGACGGCCATTATCTACTTCAG
>probe:Drosophila_2:1624205_at:158:159; Interrogation_Position=1182; Antisense; ACACACCCATCCATTGTAACTTTTT
>probe:Drosophila_2:1624205_at:151:493; Interrogation_Position=1197; Antisense; GTAACTTTTTCACATCATCCGCTAA
>probe:Drosophila_2:1624205_at:433:681; Interrogation_Position=1283; Antisense; TATGATAATCTGTCTGTCGCTTGTG
>probe:Drosophila_2:1624205_at:723:641; Interrogation_Position=1291; Antisense; TCTGTCTGTCGCTTGTGTGTATAAA
>probe:Drosophila_2:1624205_at:703:39; Interrogation_Position=1352; Antisense; ATCTGGGATCCTATGGAATGGCTTT
>probe:Drosophila_2:1624205_at:449:571; Interrogation_Position=1371; Antisense; GGCTTTTATTCTTTGATCCATTATG
>probe:Drosophila_2:1624205_at:306:449; Interrogation_Position=1385; Antisense; GATCCATTATGTACCAGTGTGCCAC
>probe:Drosophila_2:1624205_at:703:83; Interrogation_Position=1400; Antisense; AGTGTGCCACTGTTTGTCGTCCGTT
>probe:Drosophila_2:1624205_at:14:501; Interrogation_Position=1415; Antisense; GTCGTCCGTTGTTAATCGATCAATT
>probe:Drosophila_2:1624205_at:28:469; Interrogation_Position=1589; Antisense; GTTGCTTCCTAAACGTACGCATTTA
>probe:Drosophila_2:1624205_at:397:263; Interrogation_Position=1625; Antisense; CAGCTATTTCCTCCAGACAAACAAA

Paste this into a BLAST search page for me
GAACAACTTTAGACTCGGCTGCGGGTCGGCTAAGCCGGATCTTTGGACGGTTTGGACGGCCATTATCTACTTCAGACACACCCATCCATTGTAACTTTTTGTAACTTTTTCACATCATCCGCTAATATGATAATCTGTCTGTCGCTTGTGTCTGTCTGTCGCTTGTGTGTATAAAATCTGGGATCCTATGGAATGGCTTTGGCTTTTATTCTTTGATCCATTATGGATCCATTATGTACCAGTGTGCCACAGTGTGCCACTGTTTGTCGTCCGTTGTCGTCCGTTGTTAATCGATCAATTGTTGCTTCCTAAACGTACGCATTTACAGCTATTTCCTCCAGACAAACAAA

Full Affymetrix probeset data:

Annotations for 1624205_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720