FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624206_at:

>probe:Drosophila_2:1624206_at:611:213; Interrogation_Position=15; Antisense; AAGATGCGTTGCCAATTCGTTATCG
>probe:Drosophila_2:1624206_at:244:121; Interrogation_Position=179; Antisense; AGCGACTGGAACACCACCTTCAGCA
>probe:Drosophila_2:1624206_at:501:9; Interrogation_Position=29; Antisense; ATTCGTTATCGCCTTTGGGCTTTTG
>probe:Drosophila_2:1624206_at:116:153; Interrogation_Position=309; Antisense; ACATCGCCCAGTGACAGTGGATCCA
>probe:Drosophila_2:1624206_at:377:309; Interrogation_Position=331; Antisense; CCAGCAGCAGCCAGGAAGTGATTAG
>probe:Drosophila_2:1624206_at:246:219; Interrogation_Position=346; Antisense; AAGTGATTAGGCTCAGGCGTCGGCT
>probe:Drosophila_2:1624206_at:482:67; Interrogation_Position=402; Antisense; AGGCGTCAGGCCAACCAGAGTAATC
>probe:Drosophila_2:1624206_at:454:523; Interrogation_Position=45; Antisense; GGGCTTTTGGCCCTAATAGCAACTG
>probe:Drosophila_2:1624206_at:707:433; Interrogation_Position=451; Antisense; GAGTGGTTCGCCGTGTACACCGTCA
>probe:Drosophila_2:1624206_at:598:303; Interrogation_Position=470; Antisense; CCGTCACCGTCGTCTATTGTAAAAT
>probe:Drosophila_2:1624206_at:339:163; Interrogation_Position=491; Antisense; AAATTCACGAACATGTTGGCTACGA
>probe:Drosophila_2:1624206_at:377:383; Interrogation_Position=499; Antisense; GAACATGTTGGCTACGAATTTGAAA
>probe:Drosophila_2:1624206_at:69:241; Interrogation_Position=59; Antisense; AATAGCAACTGCCTACGCCGATTCT
>probe:Drosophila_2:1624206_at:113:317; Interrogation_Position=75; Antisense; GCCGATTCTCCACCTGCGGCAGGAT

Paste this into a BLAST search page for me
AAGATGCGTTGCCAATTCGTTATCGAGCGACTGGAACACCACCTTCAGCAATTCGTTATCGCCTTTGGGCTTTTGACATCGCCCAGTGACAGTGGATCCACCAGCAGCAGCCAGGAAGTGATTAGAAGTGATTAGGCTCAGGCGTCGGCTAGGCGTCAGGCCAACCAGAGTAATCGGGCTTTTGGCCCTAATAGCAACTGGAGTGGTTCGCCGTGTACACCGTCACCGTCACCGTCGTCTATTGTAAAATAAATTCACGAACATGTTGGCTACGAGAACATGTTGGCTACGAATTTGAAAAATAGCAACTGCCTACGCCGATTCTGCCGATTCTCCACCTGCGGCAGGAT

Full Affymetrix probeset data:

Annotations for 1624206_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720