Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624210_at:

>probe:Drosophila_2:1624210_at:218:363; Interrogation_Position=1616; Antisense; GAATTCGGATCTTTTGACCTTCCTG
>probe:Drosophila_2:1624210_at:561:329; Interrogation_Position=1640; Antisense; GCGTGCCCTCATCCATGTAATATAA
>probe:Drosophila_2:1624210_at:582:241; Interrogation_Position=1728; Antisense; AATAGCTCTACAGCGAATCCAGTCA
>probe:Drosophila_2:1624210_at:679:155; Interrogation_Position=1789; Antisense; ACACGCTGGCGGCAAGCTGAATGAA
>probe:Drosophila_2:1624210_at:594:369; Interrogation_Position=1807; Antisense; GAATGAACAAAAGGCCCAGGCGCTC
>probe:Drosophila_2:1624210_at:298:71; Interrogation_Position=1824; Antisense; AGGCGCTCTTCTATGCTCTGGATAC
>probe:Drosophila_2:1624210_at:33:589; Interrogation_Position=1842; Antisense; TGGATACCGACAACCTGGGCTACGT
>probe:Drosophila_2:1624210_at:251:463; Interrogation_Position=1874; Antisense; GATTCCTTTGTCGAGCTTACGGAGA
>probe:Drosophila_2:1624210_at:587:419; Interrogation_Position=1909; Antisense; GAGCTATAAATTCCTCTATCACAAA
>probe:Drosophila_2:1624210_at:177:237; Interrogation_Position=1932; Antisense; AATCGGAGCACATACGGCGACCGAA
>probe:Drosophila_2:1624210_at:598:225; Interrogation_Position=1955; Antisense; AAGGCAGTCGTCACAACGGCCGAGA
>probe:Drosophila_2:1624210_at:557:523; Interrogation_Position=1992; Antisense; GGGCACGTTTTTGCGTGTTCACAGG
>probe:Drosophila_2:1624210_at:411:421; Interrogation_Position=2055; Antisense; GAGAAATACCCAACCTAAGCAGAAT
>probe:Drosophila_2:1624210_at:669:15; Interrogation_Position=2112; Antisense; ATTTATATCGTGTACGCGTGTCCTG

Paste this into a BLAST search page for me
GAATTCGGATCTTTTGACCTTCCTGGCGTGCCCTCATCCATGTAATATAAAATAGCTCTACAGCGAATCCAGTCAACACGCTGGCGGCAAGCTGAATGAAGAATGAACAAAAGGCCCAGGCGCTCAGGCGCTCTTCTATGCTCTGGATACTGGATACCGACAACCTGGGCTACGTGATTCCTTTGTCGAGCTTACGGAGAGAGCTATAAATTCCTCTATCACAAAAATCGGAGCACATACGGCGACCGAAAAGGCAGTCGTCACAACGGCCGAGAGGGCACGTTTTTGCGTGTTCACAGGGAGAAATACCCAACCTAAGCAGAATATTTATATCGTGTACGCGTGTCCTG

Full Affymetrix probeset data:

Annotations for 1624210_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime