Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624211_at:

>probe:Drosophila_2:1624211_at:191:567; Interrogation_Position=4781; Antisense; GGCAGTTGCCCAGATACCAATTGTA
>probe:Drosophila_2:1624211_at:273:533; Interrogation_Position=4862; Antisense; GGTGGCGAAAGAAACTCCTGTGTGT
>probe:Drosophila_2:1624211_at:485:517; Interrogation_Position=4893; Antisense; GTGTGTGACAACCAACCAATTGCTT
>probe:Drosophila_2:1624211_at:524:699; Interrogation_Position=4966; Antisense; TTTTTGGTATTTGACCTCGTGCGAG
>probe:Drosophila_2:1624211_at:713:279; Interrogation_Position=4981; Antisense; CTCGTGCGAGGTTTTGTTCGTTTAG
>probe:Drosophila_2:1624211_at:549:203; Interrogation_Position=5071; Antisense; AAGCCAAGCCATCGAATTGGTCGGT
>probe:Drosophila_2:1624211_at:364:3; Interrogation_Position=5086; Antisense; ATTGGTCGGTCAGCCAGACGAGCGA
>probe:Drosophila_2:1624211_at:40:377; Interrogation_Position=5109; Antisense; GAACCAAAACTATCTGCATCCGTAT
>probe:Drosophila_2:1624211_at:267:39; Interrogation_Position=5120; Antisense; ATCTGCATCCGTATGTGCAACTGCA
>probe:Drosophila_2:1624211_at:703:359; Interrogation_Position=5136; Antisense; GCAACTGCAGTTGTATCTCTCTATC
>probe:Drosophila_2:1624211_at:714:483; Interrogation_Position=5148; Antisense; GTATCTCTCTATCTGTATCTTTTGG
>probe:Drosophila_2:1624211_at:87:163; Interrogation_Position=5178; Antisense; ACAATACGCGGGTCAAGCGGCGCAA
>probe:Drosophila_2:1624211_at:273:495; Interrogation_Position=5189; Antisense; GTCAAGCGGCGCAACTAGCAATACA
>probe:Drosophila_2:1624211_at:60:525; Interrogation_Position=5274; Antisense; GGGCATACATGCAGATACCACATAC

Paste this into a BLAST search page for me
GGCAGTTGCCCAGATACCAATTGTAGGTGGCGAAAGAAACTCCTGTGTGTGTGTGTGACAACCAACCAATTGCTTTTTTTGGTATTTGACCTCGTGCGAGCTCGTGCGAGGTTTTGTTCGTTTAGAAGCCAAGCCATCGAATTGGTCGGTATTGGTCGGTCAGCCAGACGAGCGAGAACCAAAACTATCTGCATCCGTATATCTGCATCCGTATGTGCAACTGCAGCAACTGCAGTTGTATCTCTCTATCGTATCTCTCTATCTGTATCTTTTGGACAATACGCGGGTCAAGCGGCGCAAGTCAAGCGGCGCAACTAGCAATACAGGGCATACATGCAGATACCACATAC

Full Affymetrix probeset data:

Annotations for 1624211_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime