FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624212_at:

>probe:Drosophila_2:1624212_at:503:399; Interrogation_Position=258; Antisense; GACAGGACTTCGACCTTTTTGTTAT
>probe:Drosophila_2:1624212_at:129:603; Interrogation_Position=277; Antisense; TGTTATCTTCCCTACGAATTTGGTA
>probe:Drosophila_2:1624212_at:666:241; Interrogation_Position=293; Antisense; AATTTGGTAAATGCGGAGGTCATCG
>probe:Drosophila_2:1624212_at:615:435; Interrogation_Position=308; Antisense; GAGGTCATCGCATTATGTGGGCTTT
>probe:Drosophila_2:1624212_at:657:579; Interrogation_Position=323; Antisense; TGTGGGCTTTTTCGAATAAGGAACA
>probe:Drosophila_2:1624212_at:491:159; Interrogation_Position=345; Antisense; ACAAGAGTGCGTTCCATTCGTTTTC
>probe:Drosophila_2:1624212_at:108:471; Interrogation_Position=355; Antisense; GTTCCATTCGTTTTCTCCAATTGTG
>probe:Drosophila_2:1624212_at:417:293; Interrogation_Position=363; Antisense; CGTTTTCTCCAATTGTGGCGGCAAT
>probe:Drosophila_2:1624212_at:197:583; Interrogation_Position=378; Antisense; TGGCGGCAATGAAAATCGCTTTTAT
>probe:Drosophila_2:1624212_at:467:611; Interrogation_Position=387; Antisense; TGAAAATCGCTTTTATACCAAGGAA
>probe:Drosophila_2:1624212_at:363:671; Interrogation_Position=402; Antisense; TACCAAGGAAAACTGCGAGAAAGCT
>probe:Drosophila_2:1624212_at:56:327; Interrogation_Position=416; Antisense; GCGAGAAAGCTTGCGCAACAATTCA
>probe:Drosophila_2:1624212_at:194:625; Interrogation_Position=427; Antisense; TGCGCAACAATTCAATCCCGATTTG
>probe:Drosophila_2:1624212_at:376:43; Interrogation_Position=441; Antisense; ATCCCGATTTGTTCTCGCTAATTAA

Paste this into a BLAST search page for me
GACAGGACTTCGACCTTTTTGTTATTGTTATCTTCCCTACGAATTTGGTAAATTTGGTAAATGCGGAGGTCATCGGAGGTCATCGCATTATGTGGGCTTTTGTGGGCTTTTTCGAATAAGGAACAACAAGAGTGCGTTCCATTCGTTTTCGTTCCATTCGTTTTCTCCAATTGTGCGTTTTCTCCAATTGTGGCGGCAATTGGCGGCAATGAAAATCGCTTTTATTGAAAATCGCTTTTATACCAAGGAATACCAAGGAAAACTGCGAGAAAGCTGCGAGAAAGCTTGCGCAACAATTCATGCGCAACAATTCAATCCCGATTTGATCCCGATTTGTTCTCGCTAATTAA

Full Affymetrix probeset data:

Annotations for 1624212_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720