FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624214_at:

>probe:Drosophila_2:1624214_at:538:75; Interrogation_Position=471; Antisense; AGGAGCAAGGTTCGCACGCCTACGA
>probe:Drosophila_2:1624214_at:192:437; Interrogation_Position=503; Antisense; GAGGAGCAACACGACTACGACGCTA
>probe:Drosophila_2:1624214_at:35:669; Interrogation_Position=518; Antisense; TACGACGCTAAGCTGGAGTCTCATA
>probe:Drosophila_2:1624214_at:67:551; Interrogation_Position=532; Antisense; GGAGTCTCATACCACACAATCGGAG
>probe:Drosophila_2:1624214_at:550:221; Interrogation_Position=653; Antisense; AAGGTGGTCACAATTCATCCGGAAA
>probe:Drosophila_2:1624214_at:177:395; Interrogation_Position=674; Antisense; GAAATCGCTGCTCCGAATGCGACGT
>probe:Drosophila_2:1624214_at:393:609; Interrogation_Position=706; Antisense; TGAGCCTATTGAGTCTAACCACGCG
>probe:Drosophila_2:1624214_at:50:661; Interrogation_Position=721; Antisense; TAACCACGCGGATCTGAACTACTTG
>probe:Drosophila_2:1624214_at:374:191; Interrogation_Position=737; Antisense; AACTACTTGGTCTGTATGCCGCCCA
>probe:Drosophila_2:1624214_at:497:483; Interrogation_Position=750; Antisense; GTATGCCGCCCAATGCGAATCAGGA
>probe:Drosophila_2:1624214_at:126:189; Interrogation_Position=838; Antisense; AACAGAGGACGACTTCTTTTGCAAG
>probe:Drosophila_2:1624214_at:94:275; Interrogation_Position=853; Antisense; CTTTTGCAAGTCGATTGCCGCGTAT
>probe:Drosophila_2:1624214_at:181:9; Interrogation_Position=866; Antisense; ATTGCCGCGTATTTGCGCCAACTGT
>probe:Drosophila_2:1624214_at:608:195; Interrogation_Position=885; Antisense; AACTGTCGCGCGTGCACAAGATCAA

Paste this into a BLAST search page for me
AGGAGCAAGGTTCGCACGCCTACGAGAGGAGCAACACGACTACGACGCTATACGACGCTAAGCTGGAGTCTCATAGGAGTCTCATACCACACAATCGGAGAAGGTGGTCACAATTCATCCGGAAAGAAATCGCTGCTCCGAATGCGACGTTGAGCCTATTGAGTCTAACCACGCGTAACCACGCGGATCTGAACTACTTGAACTACTTGGTCTGTATGCCGCCCAGTATGCCGCCCAATGCGAATCAGGAAACAGAGGACGACTTCTTTTGCAAGCTTTTGCAAGTCGATTGCCGCGTATATTGCCGCGTATTTGCGCCAACTGTAACTGTCGCGCGTGCACAAGATCAA

Full Affymetrix probeset data:

Annotations for 1624214_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720