FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624216_at:

>probe:Drosophila_2:1624216_at:239:95; Interrogation_Position=189; Antisense; AGTTGGAGGAGGTTGATCCGCATCC
>probe:Drosophila_2:1624216_at:392:79; Interrogation_Position=198; Antisense; AGGTTGATCCGCATCCTCAGTACAC
>probe:Drosophila_2:1624216_at:186:131; Interrogation_Position=221; Antisense; ACCTACAGCTACGACGTGCAGGACA
>probe:Drosophila_2:1624216_at:718:73; Interrogation_Position=240; Antisense; AGGACACGCTTTCCGGCGACAACAA
>probe:Drosophila_2:1624216_at:322:687; Interrogation_Position=350; Antisense; TATACCGCCGATTCCATTAACGGAT
>probe:Drosophila_2:1624216_at:664:289; Interrogation_Position=392; Antisense; CGTGAACCCCTTGCCGCTGTTGTGG
>probe:Drosophila_2:1624216_at:146:415; Interrogation_Position=422; Antisense; GAGCCGTTGCTGAAGGTTGCTGCCC
>probe:Drosophila_2:1624216_at:610:77; Interrogation_Position=435; Antisense; AGGTTGCTGCCCCATTGGTCAAGGC
>probe:Drosophila_2:1624216_at:329:503; Interrogation_Position=533; Antisense; GTCGCTGCTCCTCTGATCAAGTCCG
>probe:Drosophila_2:1624216_at:142:619; Interrogation_Position=670; Antisense; TGCGTACACCGTCGCCCAATTGTAA
>probe:Drosophila_2:1624216_at:358:321; Interrogation_Position=683; Antisense; GCCCAATTGTAAACACCCATGCGAC
>probe:Drosophila_2:1624216_at:491:307; Interrogation_Position=699; Antisense; CCATGCGACCGCTGTTATTTTGAAC
>probe:Drosophila_2:1624216_at:478:411; Interrogation_Position=705; Antisense; GACCGCTGTTATTTTGAACCCTTGT
>probe:Drosophila_2:1624216_at:440:381; Interrogation_Position=720; Antisense; GAACCCTTGTTTTGTTTCTATGATA

Paste this into a BLAST search page for me
AGTTGGAGGAGGTTGATCCGCATCCAGGTTGATCCGCATCCTCAGTACACACCTACAGCTACGACGTGCAGGACAAGGACACGCTTTCCGGCGACAACAATATACCGCCGATTCCATTAACGGATCGTGAACCCCTTGCCGCTGTTGTGGGAGCCGTTGCTGAAGGTTGCTGCCCAGGTTGCTGCCCCATTGGTCAAGGCGTCGCTGCTCCTCTGATCAAGTCCGTGCGTACACCGTCGCCCAATTGTAAGCCCAATTGTAAACACCCATGCGACCCATGCGACCGCTGTTATTTTGAACGACCGCTGTTATTTTGAACCCTTGTGAACCCTTGTTTTGTTTCTATGATA

Full Affymetrix probeset data:

Annotations for 1624216_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720