FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624221_at:

>probe:Drosophila_2:1624221_at:367:277; Interrogation_Position=205; Antisense; CTACGTCCTGGCTCTAATAATTTTT
>probe:Drosophila_2:1624221_at:72:25; Interrogation_Position=239; Antisense; ATATGCATGCATTGTATCCCGAGAA
>probe:Drosophila_2:1624221_at:371:147; Interrogation_Position=270; Antisense; ACTACTCTCCCTGTAAGTGGTTCAT
>probe:Drosophila_2:1624221_at:381:125; Interrogation_Position=353; Antisense; AGCCCGCTCATTATCAGTTTCGTGA
>probe:Drosophila_2:1624221_at:371:91; Interrogation_Position=368; Antisense; AGTTTCGTGATGATCGGCGTGGCCC
>probe:Drosophila_2:1624221_at:519:329; Interrogation_Position=384; Antisense; GCGTGGCCCTGATCATTATGTTACT
>probe:Drosophila_2:1624221_at:61:607; Interrogation_Position=474; Antisense; TGATGGCACTGCTGTTGGTCTTGAC
>probe:Drosophila_2:1624221_at:372:5; Interrogation_Position=500; Antisense; ATTGTGGGAATCGTCCAGCTCTGCA
>probe:Drosophila_2:1624221_at:666:131; Interrogation_Position=524; Antisense; ACCGGGAGTGTTGAGCTGCTCGACA
>probe:Drosophila_2:1624221_at:280:445; Interrogation_Position=571; Antisense; GATGCTGATCATAGCGATCCCCATT
>probe:Drosophila_2:1624221_at:171:69; Interrogation_Position=612; Antisense; ATGGCCGTCTGAACGTCGTGGAAGT
>probe:Drosophila_2:1624221_at:256:355; Interrogation_Position=663; Antisense; GCACCCTGACTTTATACTTGCATTC
>probe:Drosophila_2:1624221_at:529:653; Interrogation_Position=686; Antisense; TCAATGATGTTCTTCTTCTGCGTGT
>probe:Drosophila_2:1624221_at:554:667; Interrogation_Position=713; Antisense; TACTTCATCCTGGTCGACGAGAGAA

Paste this into a BLAST search page for me
CTACGTCCTGGCTCTAATAATTTTTATATGCATGCATTGTATCCCGAGAAACTACTCTCCCTGTAAGTGGTTCATAGCCCGCTCATTATCAGTTTCGTGAAGTTTCGTGATGATCGGCGTGGCCCGCGTGGCCCTGATCATTATGTTACTTGATGGCACTGCTGTTGGTCTTGACATTGTGGGAATCGTCCAGCTCTGCAACCGGGAGTGTTGAGCTGCTCGACAGATGCTGATCATAGCGATCCCCATTATGGCCGTCTGAACGTCGTGGAAGTGCACCCTGACTTTATACTTGCATTCTCAATGATGTTCTTCTTCTGCGTGTTACTTCATCCTGGTCGACGAGAGAA

Full Affymetrix probeset data:

Annotations for 1624221_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720