FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624226_at:

>probe:Drosophila_2:1624226_at:152:387; Interrogation_Position=1043; Antisense; GAAAACTTCGGAGGCGCTTTGTCCA
>probe:Drosophila_2:1624226_at:247:693; Interrogation_Position=1060; Antisense; TTTGTCCATGGACCACATTCGTGAT
>probe:Drosophila_2:1624226_at:564:369; Interrogation_Position=1186; Antisense; GAAGGCATTGCCAGCCCATGGCGAT
>probe:Drosophila_2:1624226_at:582:573; Interrogation_Position=1205; Antisense; GGCGATTTGGTGTTTCACAACTTTA
>probe:Drosophila_2:1624226_at:334:149; Interrogation_Position=1224; Antisense; ACTTTATCACTACCATCCATCAGAA
>probe:Drosophila_2:1624226_at:729:365; Interrogation_Position=1246; Antisense; GAATCCGGGCCAGCTGTTGAGATAT
>probe:Drosophila_2:1624226_at:483:603; Interrogation_Position=1377; Antisense; TGATTCCCAAGCTGCGGTTCCAGGT
>probe:Drosophila_2:1624226_at:651:541; Interrogation_Position=1406; Antisense; GGTTGCAATGCACCAATCGAGTTTG
>probe:Drosophila_2:1624226_at:584:691; Interrogation_Position=1427; Antisense; TTTGGCAACGTGCTGGTCTTCACCT
>probe:Drosophila_2:1624226_at:37:131; Interrogation_Position=1448; Antisense; ACCTGCCTCAAGAGCTGCTGGGACA
>probe:Drosophila_2:1624226_at:421:295; Interrogation_Position=1477; Antisense; CGACCTGATGCGCTACGAACATATT
>probe:Drosophila_2:1624226_at:277:297; Interrogation_Position=923; Antisense; CGCGACCTGATTGCCTTGTTGAAGC
>probe:Drosophila_2:1624226_at:114:547; Interrogation_Position=976; Antisense; GGACCTAACGCTAAAGTCTTACTAT
>probe:Drosophila_2:1624226_at:274:87; Interrogation_Position=990; Antisense; AGTCTTACTATATTGCCGTCGATGT

Paste this into a BLAST search page for me
GAAAACTTCGGAGGCGCTTTGTCCATTTGTCCATGGACCACATTCGTGATGAAGGCATTGCCAGCCCATGGCGATGGCGATTTGGTGTTTCACAACTTTAACTTTATCACTACCATCCATCAGAAGAATCCGGGCCAGCTGTTGAGATATTGATTCCCAAGCTGCGGTTCCAGGTGGTTGCAATGCACCAATCGAGTTTGTTTGGCAACGTGCTGGTCTTCACCTACCTGCCTCAAGAGCTGCTGGGACACGACCTGATGCGCTACGAACATATTCGCGACCTGATTGCCTTGTTGAAGCGGACCTAACGCTAAAGTCTTACTATAGTCTTACTATATTGCCGTCGATGT

Full Affymetrix probeset data:

Annotations for 1624226_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720