FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624228_at:

>probe:Drosophila_2:1624228_at:303:125; Interrogation_Position=108; Antisense; AGCCTAACCGCAGTTTTCCAGATGG
>probe:Drosophila_2:1624228_at:262:353; Interrogation_Position=137; Antisense; GCAGCGATTGATAGCCCCAGCGATA
>probe:Drosophila_2:1624228_at:217:195; Interrogation_Position=165; Antisense; AACTGGGCACGTTTTTATGCTGCAA
>probe:Drosophila_2:1624228_at:218:209; Interrogation_Position=219; Antisense; AAGCTTGGCAAGCTGGGTCCCATCA
>probe:Drosophila_2:1624228_at:79:305; Interrogation_Position=361; Antisense; CCGACTGGCTGTGGACGCTGAATAC
>probe:Drosophila_2:1624228_at:718:369; Interrogation_Position=387; Antisense; GAAGGCATAGTTCCGCTGGACGAAC
>probe:Drosophila_2:1624228_at:305:73; Interrogation_Position=447; Antisense; AGGAAACTGGCCTTGCGGCGCAACA
>probe:Drosophila_2:1624228_at:645:575; Interrogation_Position=463; Antisense; GGCGCAACAATCAGCTGTCCAAGCT
>probe:Drosophila_2:1624228_at:57:375; Interrogation_Position=491; Antisense; GAAGTTCTAGAACCCATAGCCCTAG
>probe:Drosophila_2:1624228_at:609:671; Interrogation_Position=507; Antisense; TAGCCCTAGGTGTTATCGTTGATTT
>probe:Drosophila_2:1624228_at:642:603; Interrogation_Position=526; Antisense; TGATTTTGGAGACACAGCCGACCGT
>probe:Drosophila_2:1624228_at:115:155; Interrogation_Position=552; Antisense; ACAGCGGCCCATGTTGTTTGCGATG
>probe:Drosophila_2:1624228_at:120:695; Interrogation_Position=568; Antisense; TTTGCGATGCTCTCCTGAGCAACAA
>probe:Drosophila_2:1624228_at:144:27; Interrogation_Position=93; Antisense; ATAGCAGACATGACCAGCCTAACCG

Paste this into a BLAST search page for me
AGCCTAACCGCAGTTTTCCAGATGGGCAGCGATTGATAGCCCCAGCGATAAACTGGGCACGTTTTTATGCTGCAAAAGCTTGGCAAGCTGGGTCCCATCACCGACTGGCTGTGGACGCTGAATACGAAGGCATAGTTCCGCTGGACGAACAGGAAACTGGCCTTGCGGCGCAACAGGCGCAACAATCAGCTGTCCAAGCTGAAGTTCTAGAACCCATAGCCCTAGTAGCCCTAGGTGTTATCGTTGATTTTGATTTTGGAGACACAGCCGACCGTACAGCGGCCCATGTTGTTTGCGATGTTTGCGATGCTCTCCTGAGCAACAAATAGCAGACATGACCAGCCTAACCG

Full Affymetrix probeset data:

Annotations for 1624228_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720