FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624229_at:

>probe:Drosophila_2:1624229_at:235:187; Interrogation_Position=101; Antisense; AACAGCGCCTAAAACCCAAGAAGCT
>probe:Drosophila_2:1624229_at:696:189; Interrogation_Position=131; Antisense; AACATCCAGGAACTCAGAAGGTCGA
>probe:Drosophila_2:1624229_at:477:531; Interrogation_Position=180; Antisense; GGTAGCGGATCAGTCGGTTGAATAC
>probe:Drosophila_2:1624229_at:119:463; Interrogation_Position=205; Antisense; GATTACATGAAGTATCCCAGCAATA
>probe:Drosophila_2:1624229_at:618:369; Interrogation_Position=234; Antisense; GAAGGCAAAACTCCTGAAAGGCGTT
>probe:Drosophila_2:1624229_at:101:565; Interrogation_Position=253; Antisense; GGCGTTAAACCATCGAAAAGTGTCA
>probe:Drosophila_2:1624229_at:696:169; Interrogation_Position=269; Antisense; AAAGTGTCACATTCAAGACGGTGGT
>probe:Drosophila_2:1624229_at:487:417; Interrogation_Position=295; Antisense; GAGCTGGTGACCTATTCGGAAAACT
>probe:Drosophila_2:1624229_at:50:457; Interrogation_Position=33; Antisense; GATACATTTTTGATAGCTGAGCAAC
>probe:Drosophila_2:1624229_at:250:375; Interrogation_Position=369; Antisense; GAAGAGCTCCCAAAAATATCGCAAC
>probe:Drosophila_2:1624229_at:591:679; Interrogation_Position=385; Antisense; TATCGCAACTACTGACAACTTTCCT
>probe:Drosophila_2:1624229_at:538:183; Interrogation_Position=58; Antisense; AAAATCATACCAAATTCCCCTCTGA
>probe:Drosophila_2:1624229_at:176:163; Interrogation_Position=69; Antisense; AAATTCCCCTCTGAACATGGACAGC
>probe:Drosophila_2:1624229_at:11:587; Interrogation_Position=86; Antisense; TGGACAGCCCAGTAAAACAGCGCCT

Paste this into a BLAST search page for me
AACAGCGCCTAAAACCCAAGAAGCTAACATCCAGGAACTCAGAAGGTCGAGGTAGCGGATCAGTCGGTTGAATACGATTACATGAAGTATCCCAGCAATAGAAGGCAAAACTCCTGAAAGGCGTTGGCGTTAAACCATCGAAAAGTGTCAAAAGTGTCACATTCAAGACGGTGGTGAGCTGGTGACCTATTCGGAAAACTGATACATTTTTGATAGCTGAGCAACGAAGAGCTCCCAAAAATATCGCAACTATCGCAACTACTGACAACTTTCCTAAAATCATACCAAATTCCCCTCTGAAAATTCCCCTCTGAACATGGACAGCTGGACAGCCCAGTAAAACAGCGCCT

Full Affymetrix probeset data:

Annotations for 1624229_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720