FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624232_at:

>probe:Drosophila_2:1624232_at:357:569; Interrogation_Position=131; Antisense; GGCATTATCGGGACCACCTGGAGGC
>probe:Drosophila_2:1624232_at:724:437; Interrogation_Position=151; Antisense; GAGGCCGCTGAAGGGACCTAACACT
>probe:Drosophila_2:1624232_at:410:31; Interrogation_Position=183; Antisense; ATAAACAGCTTCGTCATGGCGGCTC
>probe:Drosophila_2:1624232_at:487:531; Interrogation_Position=209; Antisense; GGTGGACGAAAGCAACTACGCCTAT
>probe:Drosophila_2:1624232_at:512:213; Interrogation_Position=282; Antisense; AAGAGCAATATCTTTTCGCCCACGA
>probe:Drosophila_2:1624232_at:452:115; Interrogation_Position=309; Antisense; AGCATGCAGGCGGTTGATTCCCAAC
>probe:Drosophila_2:1624232_at:266:223; Interrogation_Position=350; Antisense; AAGGTCGCGGACACAGTCGATGATT
>probe:Drosophila_2:1624232_at:638:57; Interrogation_Position=369; Antisense; ATGATTCCGGCCGAGAGACGCGAGT
>probe:Drosophila_2:1624232_at:541:227; Interrogation_Position=464; Antisense; AATGGAGCCAGACCGCATTCGGGTT
>probe:Drosophila_2:1624232_at:222:675; Interrogation_Position=488; Antisense; TAGCGGAGACATTCTGCTCTACATC
>probe:Drosophila_2:1624232_at:195:339; Interrogation_Position=503; Antisense; GCTCTACATCTACCAACCGATTTTT
>probe:Drosophila_2:1624232_at:363:515; Interrogation_Position=528; Antisense; GTGTCAAACACAGTGATGGCCTCCA
>probe:Drosophila_2:1624232_at:392:13; Interrogation_Position=552; Antisense; ATTCAAGCCTGGTCGCCCAGTGAAA
>probe:Drosophila_2:1624232_at:406:677; Interrogation_Position=611; Antisense; TAGAGAAGAGAACCCCACGGCTAAG

Paste this into a BLAST search page for me
GGCATTATCGGGACCACCTGGAGGCGAGGCCGCTGAAGGGACCTAACACTATAAACAGCTTCGTCATGGCGGCTCGGTGGACGAAAGCAACTACGCCTATAAGAGCAATATCTTTTCGCCCACGAAGCATGCAGGCGGTTGATTCCCAACAAGGTCGCGGACACAGTCGATGATTATGATTCCGGCCGAGAGACGCGAGTAATGGAGCCAGACCGCATTCGGGTTTAGCGGAGACATTCTGCTCTACATCGCTCTACATCTACCAACCGATTTTTGTGTCAAACACAGTGATGGCCTCCAATTCAAGCCTGGTCGCCCAGTGAAATAGAGAAGAGAACCCCACGGCTAAG

Full Affymetrix probeset data:

Annotations for 1624232_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720