FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624233_at:

>probe:Drosophila_2:1624233_at:620:649; Interrogation_Position=1008; Antisense; TCAGAACTTTTCACTGCAACTCCTG
>probe:Drosophila_2:1624233_at:115:29; Interrogation_Position=1042; Antisense; ATACGAATCGATTGCCTCGGCCTGA
>probe:Drosophila_2:1624233_at:465:129; Interrogation_Position=1066; Antisense; ACCATCCTGGATTGCAGTCTTCTAA
>probe:Drosophila_2:1624233_at:50:85; Interrogation_Position=1081; Antisense; AGTCTTCTAACTCGGATGGCCTGTT
>probe:Drosophila_2:1624233_at:364:305; Interrogation_Position=1106; Antisense; CCGTGGGCACCTACATGATCTATAG
>probe:Drosophila_2:1624233_at:176:119; Interrogation_Position=581; Antisense; AGCTGACCGGCTTGGAACGCGAAAT
>probe:Drosophila_2:1624233_at:477:167; Interrogation_Position=602; Antisense; AAATGGGTCTGCTGGCGGAGTACTC
>probe:Drosophila_2:1624233_at:643:589; Interrogation_Position=660; Antisense; TGGATTCGAAAGTTTCCTGCGCCGA
>probe:Drosophila_2:1624233_at:625:353; Interrogation_Position=699; Antisense; GCAGCGCATCTATAGCCATGTGTAT
>probe:Drosophila_2:1624233_at:726:617; Interrogation_Position=728; Antisense; TGCTCAAATGTTTCCAGGGTGCCTT
>probe:Drosophila_2:1624233_at:27:521; Interrogation_Position=802; Antisense; GTGGACTGCTACTTCATGTACTACA
>probe:Drosophila_2:1624233_at:331:265; Interrogation_Position=910; Antisense; CAGAGCTGCATGGTCGTGGTGCCCA
>probe:Drosophila_2:1624233_at:616:345; Interrogation_Position=951; Antisense; GCATAATATAGTCACCGATTCCGGT
>probe:Drosophila_2:1624233_at:573:37; Interrogation_Position=992; Antisense; ATCTCTCCCTGCAGATTCAGAACTT

Paste this into a BLAST search page for me
TCAGAACTTTTCACTGCAACTCCTGATACGAATCGATTGCCTCGGCCTGAACCATCCTGGATTGCAGTCTTCTAAAGTCTTCTAACTCGGATGGCCTGTTCCGTGGGCACCTACATGATCTATAGAGCTGACCGGCTTGGAACGCGAAATAAATGGGTCTGCTGGCGGAGTACTCTGGATTCGAAAGTTTCCTGCGCCGAGCAGCGCATCTATAGCCATGTGTATTGCTCAAATGTTTCCAGGGTGCCTTGTGGACTGCTACTTCATGTACTACACAGAGCTGCATGGTCGTGGTGCCCAGCATAATATAGTCACCGATTCCGGTATCTCTCCCTGCAGATTCAGAACTT

Full Affymetrix probeset data:

Annotations for 1624233_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720