FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624234_at:

>probe:Drosophila_2:1624234_at:63:387; Interrogation_Position=136; Antisense; GAACAGACATCCATTGTGGTGCCCA
>probe:Drosophila_2:1624234_at:715:533; Interrogation_Position=153; Antisense; GGTGCCCACAGTTGGCTTCATGGTG
>probe:Drosophila_2:1624234_at:161:273; Interrogation_Position=189; Antisense; CATAGGCATGTCAGGTGTTTCCATT
>probe:Drosophila_2:1624234_at:30:225; Interrogation_Position=214; Antisense; AAGGCAATCGACATGTCCGGTGCGA
>probe:Drosophila_2:1624234_at:38:477; Interrogation_Position=295; Antisense; GTTATTGATTCCAGCGATCGCATGA
>probe:Drosophila_2:1624234_at:542:347; Interrogation_Position=360; Antisense; GCATCCGGACTTGTGCAACCGAATT
>probe:Drosophila_2:1624234_at:8:363; Interrogation_Position=380; Antisense; GAATTGTGCCAATTCTCTTCTACGG
>probe:Drosophila_2:1624234_at:216:549; Interrogation_Position=420; Antisense; GGAGGACTCGCTATCCAGTGTGAAA
>probe:Drosophila_2:1624234_at:591:169; Interrogation_Position=474; Antisense; AAAGGACAAACCCTGGCACATCTGC
>probe:Drosophila_2:1624234_at:62:279; Interrogation_Position=509; Antisense; CTATATCCGGCGAAGGTCTGGGCGA
>probe:Drosophila_2:1624234_at:425:327; Interrogation_Position=530; Antisense; GCGAGGGTGTCCAATGGCTCATCCA
>probe:Drosophila_2:1624234_at:653:581; Interrogation_Position=544; Antisense; TGGCTCATCCAGCAAATGCGTTTCG
>probe:Drosophila_2:1624234_at:172:167; Interrogation_Position=585; Antisense; AAATGCCGCCAAATCCAGGTCCAAG
>probe:Drosophila_2:1624234_at:118:57; Interrogation_Position=64; Antisense; ATGACGATTCTGGTGCTGGGACTGA

Paste this into a BLAST search page for me
GAACAGACATCCATTGTGGTGCCCAGGTGCCCACAGTTGGCTTCATGGTGCATAGGCATGTCAGGTGTTTCCATTAAGGCAATCGACATGTCCGGTGCGAGTTATTGATTCCAGCGATCGCATGAGCATCCGGACTTGTGCAACCGAATTGAATTGTGCCAATTCTCTTCTACGGGGAGGACTCGCTATCCAGTGTGAAAAAAGGACAAACCCTGGCACATCTGCCTATATCCGGCGAAGGTCTGGGCGAGCGAGGGTGTCCAATGGCTCATCCATGGCTCATCCAGCAAATGCGTTTCGAAATGCCGCCAAATCCAGGTCCAAGATGACGATTCTGGTGCTGGGACTGA

Full Affymetrix probeset data:

Annotations for 1624234_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720