Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624235_at:

>probe:Drosophila_2:1624235_at:499:91; Interrogation_Position=4013; Antisense; AGTTTCCATCTTTTACCAGTCGAAT
>probe:Drosophila_2:1624235_at:9:391; Interrogation_Position=4094; Antisense; GAAATCGTTTTCAGTCGTTTTTGTG
>probe:Drosophila_2:1624235_at:223:401; Interrogation_Position=4131; Antisense; GACATTAGACGGTTTCCTGATCGAT
>probe:Drosophila_2:1624235_at:69:655; Interrogation_Position=4188; Antisense; TAATTCTTGAATTGGGCGGGTCCTA
>probe:Drosophila_2:1624235_at:66:711; Interrogation_Position=4199; Antisense; TTGGGCGGGTCCTAGACAGTCTAAT
>probe:Drosophila_2:1624235_at:511:1; Interrogation_Position=4339; Antisense; AGTCGTAACCACACTAAGCCAAGCG
>probe:Drosophila_2:1624235_at:59:205; Interrogation_Position=4354; Antisense; AAGCCAAGCGCGTTACTCAAGCAAT
>probe:Drosophila_2:1624235_at:54:491; Interrogation_Position=4426; Antisense; GTAAATTATCCTGGTTTGTCCTGCC
>probe:Drosophila_2:1624235_at:79:599; Interrogation_Position=4442; Antisense; TGTCCTGCCCTTAGTTCTTCTTTAA
>probe:Drosophila_2:1624235_at:247:45; Interrogation_Position=4481; Antisense; ATCCCACTTACTGCGGATGGACGGA
>probe:Drosophila_2:1624235_at:725:207; Interrogation_Position=4518; Antisense; AAGCTTGCTCGAAAACGGTTCCTGT
>probe:Drosophila_2:1624235_at:307:719; Interrogation_Position=4536; Antisense; TTCCTGTTCCGCTTTTGGTTGTAAT
>probe:Drosophila_2:1624235_at:232:451; Interrogation_Position=4562; Antisense; GATCTCTGACCTGAAAACTGTATTG
>probe:Drosophila_2:1624235_at:542:143; Interrogation_Position=4578; Antisense; ACTGTATTGTGTTCAACGGATGCTC

Paste this into a BLAST search page for me
AGTTTCCATCTTTTACCAGTCGAATGAAATCGTTTTCAGTCGTTTTTGTGGACATTAGACGGTTTCCTGATCGATTAATTCTTGAATTGGGCGGGTCCTATTGGGCGGGTCCTAGACAGTCTAATAGTCGTAACCACACTAAGCCAAGCGAAGCCAAGCGCGTTACTCAAGCAATGTAAATTATCCTGGTTTGTCCTGCCTGTCCTGCCCTTAGTTCTTCTTTAAATCCCACTTACTGCGGATGGACGGAAAGCTTGCTCGAAAACGGTTCCTGTTTCCTGTTCCGCTTTTGGTTGTAATGATCTCTGACCTGAAAACTGTATTGACTGTATTGTGTTCAACGGATGCTC

Full Affymetrix probeset data:

Annotations for 1624235_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime