Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624236_at:

>probe:Drosophila_2:1624236_at:647:97; Interrogation_Position=1003; Antisense; AGATGGCAGAATTCTCGGATGTTTA
>probe:Drosophila_2:1624236_at:682:609; Interrogation_Position=479; Antisense; TGACTGCACCACCTACAATTATGAA
>probe:Drosophila_2:1624236_at:664:243; Interrogation_Position=495; Antisense; AATTATGAACGGGTTTGCGCTCCGC
>probe:Drosophila_2:1624236_at:316:53; Interrogation_Position=499; Antisense; ATGAACGGGTTTGCGCTCCGCCCGT
>probe:Drosophila_2:1624236_at:202:723; Interrogation_Position=684; Antisense; TTGCAGCTGGGACAACGCTTCATGG
>probe:Drosophila_2:1624236_at:353:389; Interrogation_Position=694; Antisense; GACAACGCTTCATGGCGGTGGGCTG
>probe:Drosophila_2:1624236_at:389:197; Interrogation_Position=725; Antisense; AACGGAGAGTCTACGCTATGCCAAC
>probe:Drosophila_2:1624236_at:113:427; Interrogation_Position=729; Antisense; GAGAGTCTACGCTATGCCAACAGTA
>probe:Drosophila_2:1624236_at:419:643; Interrogation_Position=734; Antisense; TCTACGCTATGCCAACAGTACAATG
>probe:Drosophila_2:1624236_at:250:541; Interrogation_Position=764; Antisense; GGATATAAGAACTGAGAAGTGCACC
>probe:Drosophila_2:1624236_at:621:529; Interrogation_Position=796; Antisense; GGGATACTTCGTTCCTCTGCGCCAG
>probe:Drosophila_2:1624236_at:117:471; Interrogation_Position=806; Antisense; GTTCCTCTGCGCCAGTGGAGATTAT
>probe:Drosophila_2:1624236_at:585:261; Interrogation_Position=977; Antisense; CACCTATATGCCCTGGATACTTGAA
>probe:Drosophila_2:1624236_at:10:683; Interrogation_Position=983; Antisense; TATGCCCTGGATACTTGAAAAGATG

Paste this into a BLAST search page for me
AGATGGCAGAATTCTCGGATGTTTATGACTGCACCACCTACAATTATGAAAATTATGAACGGGTTTGCGCTCCGCATGAACGGGTTTGCGCTCCGCCCGTTTGCAGCTGGGACAACGCTTCATGGGACAACGCTTCATGGCGGTGGGCTGAACGGAGAGTCTACGCTATGCCAACGAGAGTCTACGCTATGCCAACAGTATCTACGCTATGCCAACAGTACAATGGGATATAAGAACTGAGAAGTGCACCGGGATACTTCGTTCCTCTGCGCCAGGTTCCTCTGCGCCAGTGGAGATTATCACCTATATGCCCTGGATACTTGAATATGCCCTGGATACTTGAAAAGATG

Full Affymetrix probeset data:

Annotations for 1624236_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime