Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624237_at:

>probe:Drosophila_2:1624237_at:228:51; Interrogation_Position=7809; Antisense; ATGAAAACCGGCTGTTGCCCAACGG
>probe:Drosophila_2:1624237_at:512:141; Interrogation_Position=7830; Antisense; ACGGCAGACGCAGTCGCAGATCCAA
>probe:Drosophila_2:1624237_at:26:449; Interrogation_Position=7848; Antisense; GATCCAAGCGAGTGGGTCACACTTC
>probe:Drosophila_2:1624237_at:588:537; Interrogation_Position=7862; Antisense; GGTCACACTTCGAGCTCAAGCTGAA
>probe:Drosophila_2:1624237_at:657:283; Interrogation_Position=7888; Antisense; CTGAACCTAGGTATGGAGTCTGCCA
>probe:Drosophila_2:1624237_at:652:285; Interrogation_Position=7937; Antisense; CTGTGCGAATACTGGCGGCCGTGCA
>probe:Drosophila_2:1624237_at:518:577; Interrogation_Position=7953; Antisense; GGCCGTGCAGGCTAAGCTAACTACC
>probe:Drosophila_2:1624237_at:269:337; Interrogation_Position=7968; Antisense; GCTAACTACCCAAAATGCCGAGACG
>probe:Drosophila_2:1624237_at:187:425; Interrogation_Position=7987; Antisense; GAGACGAGCTTTACGCAGTCGCAAA
>probe:Drosophila_2:1624237_at:317:409; Interrogation_Position=8085; Antisense; GACGATGCCGAGTATGATAGCTAGC
>probe:Drosophila_2:1624237_at:448:727; Interrogation_Position=8144; Antisense; TTGTCCGTAGTGTGATCGATCGTTT
>probe:Drosophila_2:1624237_at:415:209; Interrogation_Position=8185; Antisense; AAGAACGCGGTAGCCCAATAGCCAA
>probe:Drosophila_2:1624237_at:457:27; Interrogation_Position=8202; Antisense; ATAGCCAATAGCACCCTGTATGTAT
>probe:Drosophila_2:1624237_at:396:457; Interrogation_Position=8255; Antisense; GATAGTTGATCCCAAGTCGATGTGA

Paste this into a BLAST search page for me
ATGAAAACCGGCTGTTGCCCAACGGACGGCAGACGCAGTCGCAGATCCAAGATCCAAGCGAGTGGGTCACACTTCGGTCACACTTCGAGCTCAAGCTGAACTGAACCTAGGTATGGAGTCTGCCACTGTGCGAATACTGGCGGCCGTGCAGGCCGTGCAGGCTAAGCTAACTACCGCTAACTACCCAAAATGCCGAGACGGAGACGAGCTTTACGCAGTCGCAAAGACGATGCCGAGTATGATAGCTAGCTTGTCCGTAGTGTGATCGATCGTTTAAGAACGCGGTAGCCCAATAGCCAAATAGCCAATAGCACCCTGTATGTATGATAGTTGATCCCAAGTCGATGTGA

Full Affymetrix probeset data:

Annotations for 1624237_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime