FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624239_at:

>probe:Drosophila_2:1624239_at:129:287; Interrogation_Position=408; Antisense; CTGGGCTGGTTCTGCACTGGGAAAT
>probe:Drosophila_2:1624239_at:532:503; Interrogation_Position=449; Antisense; GTCCCTGATCCACGACTATTATGTC
>probe:Drosophila_2:1624239_at:161:547; Interrogation_Position=512; Antisense; GGATGCAGCCCTGAAGAACCAGCGA
>probe:Drosophila_2:1624239_at:406:521; Interrogation_Position=580; Antisense; GTGGCACCAAAGGACTGATGTTCTC
>probe:Drosophila_2:1624239_at:421:607; Interrogation_Position=595; Antisense; TGATGTTCTCATTAGTTCCACTGGA
>probe:Drosophila_2:1624239_at:509:183; Interrogation_Position=631; Antisense; AAAATTCCGATTTGGTGGCTCTGCG
>probe:Drosophila_2:1624239_at:543:357; Interrogation_Position=692; Antisense; GCAAATGGAGCGCTTCGTCCCAGAG
>probe:Drosophila_2:1624239_at:95:639; Interrogation_Position=706; Antisense; TCGTCCCAGAGTTGGCTCAAGTGGT
>probe:Drosophila_2:1624239_at:217:543; Interrogation_Position=743; Antisense; GGATATGCAACATCGCCTTGACTTG
>probe:Drosophila_2:1624239_at:551:535; Interrogation_Position=767; Antisense; GGTGCTGCGCTACATCAACGATGTC
>probe:Drosophila_2:1624239_at:625:151; Interrogation_Position=778; Antisense; ACATCAACGATGTCTTGGCCAGGAA
>probe:Drosophila_2:1624239_at:232:641; Interrogation_Position=870; Antisense; TCGGACAAATTTCGCGTCATGTTTA
>probe:Drosophila_2:1624239_at:297:435; Interrogation_Position=905; Antisense; GAGGGATATGCTCATGGCCATCACT
>probe:Drosophila_2:1624239_at:264:391; Interrogation_Position=968; Antisense; GAAACTGTCTTGCATGCAGGATCAG

Paste this into a BLAST search page for me
CTGGGCTGGTTCTGCACTGGGAAATGTCCCTGATCCACGACTATTATGTCGGATGCAGCCCTGAAGAACCAGCGAGTGGCACCAAAGGACTGATGTTCTCTGATGTTCTCATTAGTTCCACTGGAAAAATTCCGATTTGGTGGCTCTGCGGCAAATGGAGCGCTTCGTCCCAGAGTCGTCCCAGAGTTGGCTCAAGTGGTGGATATGCAACATCGCCTTGACTTGGGTGCTGCGCTACATCAACGATGTCACATCAACGATGTCTTGGCCAGGAATCGGACAAATTTCGCGTCATGTTTAGAGGGATATGCTCATGGCCATCACTGAAACTGTCTTGCATGCAGGATCAG

Full Affymetrix probeset data:

Annotations for 1624239_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720