FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624240_at:

>probe:Drosophila_2:1624240_at:288:315; Interrogation_Position=1054; Antisense; GCCTTTCAGCCGGTCAATAGTTTAC
>probe:Drosophila_2:1624240_at:10:479; Interrogation_Position=1073; Antisense; GTTTACGCATATTTATTCCGCATTG
>probe:Drosophila_2:1624240_at:334:633; Interrogation_Position=1089; Antisense; TCCGCATTGAGCCAAAGCCGCATAT
>probe:Drosophila_2:1624240_at:164:215; Interrogation_Position=1141; Antisense; AAGAGTGCACTCTAGCTTGATGCTA
>probe:Drosophila_2:1624240_at:359:373; Interrogation_Position=579; Antisense; GAAGTGGACATTGACCGCGGAGTAC
>probe:Drosophila_2:1624240_at:216:105; Interrogation_Position=668; Antisense; AGACGAGAAGTTCACCGCCGATCAT
>probe:Drosophila_2:1624240_at:277:101; Interrogation_Position=707; Antisense; AGAGGGCCAGACGAATGCCGCCAAT
>probe:Drosophila_2:1624240_at:687:127; Interrogation_Position=748; Antisense; ACCACTTCATCGCACTGGTGAACAA
>probe:Drosophila_2:1624240_at:161:147; Interrogation_Position=780; Antisense; ACTCTGTACGAGCTGGATGGCCGCA
>probe:Drosophila_2:1624240_at:369:411; Interrogation_Position=826; Antisense; GACCGACTTCGGAGGAGACTTTTGT
>probe:Drosophila_2:1624240_at:199:331; Interrogation_Position=858; Antisense; GCGGCCAAGGTCTGCAAGGAGTTCA
>probe:Drosophila_2:1624240_at:671:197; Interrogation_Position=897; Antisense; AACGAAGTGCGCTTCACCGTTTTGG
>probe:Drosophila_2:1624240_at:168:195; Interrogation_Position=962; Antisense; AACTGAGAACCACCAAGATCCCGGA
>probe:Drosophila_2:1624240_at:585:449; Interrogation_Position=978; Antisense; GATCCCGGATCTGCCAGACTATATA

Paste this into a BLAST search page for me
GCCTTTCAGCCGGTCAATAGTTTACGTTTACGCATATTTATTCCGCATTGTCCGCATTGAGCCAAAGCCGCATATAAGAGTGCACTCTAGCTTGATGCTAGAAGTGGACATTGACCGCGGAGTACAGACGAGAAGTTCACCGCCGATCATAGAGGGCCAGACGAATGCCGCCAATACCACTTCATCGCACTGGTGAACAAACTCTGTACGAGCTGGATGGCCGCAGACCGACTTCGGAGGAGACTTTTGTGCGGCCAAGGTCTGCAAGGAGTTCAAACGAAGTGCGCTTCACCGTTTTGGAACTGAGAACCACCAAGATCCCGGAGATCCCGGATCTGCCAGACTATATA

Full Affymetrix probeset data:

Annotations for 1624240_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720