Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624241_at:

>probe:Drosophila_2:1624241_at:138:507; Interrogation_Position=2629; Antisense; TTCCAAGAAACTCGCCTTGTTTTGT
>probe:Drosophila_2:1624241_at:64:443; Interrogation_Position=2653; Antisense; TTACTTTTTAAGTGTTGTTCTCTCT
>probe:Drosophila_2:1624241_at:389:467; Interrogation_Position=2666; Antisense; GTTGTTCTCTCTTTTAAGTCTCCAT
>probe:Drosophila_2:1624241_at:414:219; Interrogation_Position=2681; Antisense; AAGTCTCCATTGTGATCGCATTAAG
>probe:Drosophila_2:1624241_at:474:507; Interrogation_Position=2737; Antisense; GTGAATAACGTACACTCCGAGTGGG
>probe:Drosophila_2:1624241_at:573:183; Interrogation_Position=2770; Antisense; AACAAATCCCGAATAACTTATGCAC
>probe:Drosophila_2:1624241_at:519:271; Interrogation_Position=2803; Antisense; CATTCAGGGCACTTTGCTACTCTAA
>probe:Drosophila_2:1624241_at:191:339; Interrogation_Position=2818; Antisense; GCTACTCTAACTCTACTTTCATAAC
>probe:Drosophila_2:1624241_at:297:709; Interrogation_Position=2843; Antisense; TTAACAACAGACAATCAGACAGCGA
>probe:Drosophila_2:1624241_at:10:513; Interrogation_Position=2953; Antisense; GTGATTTTAACTGCAATTTTTACAC
>probe:Drosophila_2:1624241_at:643:105; Interrogation_Position=3048; Antisense; AGAAACCAAACACTCGTCAATTAAG
>probe:Drosophila_2:1624241_at:652:237; Interrogation_Position=3081; Antisense; AATATTGGTACGTACTCGTATTCGA
>probe:Drosophila_2:1624241_at:594:145; Interrogation_Position=3094; Antisense; ACTCGTATTCGATTGTACATAAACG
>probe:Drosophila_2:1624241_at:38:363; Interrogation_Position=3149; Antisense; GCAATAGAACCTGATTCCAACCACA

Paste this into a BLAST search page for me
TTCCAAGAAACTCGCCTTGTTTTGTTTACTTTTTAAGTGTTGTTCTCTCTGTTGTTCTCTCTTTTAAGTCTCCATAAGTCTCCATTGTGATCGCATTAAGGTGAATAACGTACACTCCGAGTGGGAACAAATCCCGAATAACTTATGCACCATTCAGGGCACTTTGCTACTCTAAGCTACTCTAACTCTACTTTCATAACTTAACAACAGACAATCAGACAGCGAGTGATTTTAACTGCAATTTTTACACAGAAACCAAACACTCGTCAATTAAGAATATTGGTACGTACTCGTATTCGAACTCGTATTCGATTGTACATAAACGGCAATAGAACCTGATTCCAACCACA

Full Affymetrix probeset data:

Annotations for 1624241_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime