Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624242_at:

>probe:Drosophila_2:1624242_at:474:393; Interrogation_Position=2694; Antisense; GAAATCTGGTTCTGTTCGCTTTGCC
>probe:Drosophila_2:1624242_at:608:231; Interrogation_Position=2739; Antisense; AATGATCAAGGATCTGCACCCCACA
>probe:Drosophila_2:1624242_at:466:631; Interrogation_Position=2795; Antisense; TCCTGGTCATGACTGAATTCGCTTT
>probe:Drosophila_2:1624242_at:495:363; Interrogation_Position=2809; Antisense; GAATTCGCTTTGAACTTACTTCGCA
>probe:Drosophila_2:1624242_at:610:43; Interrogation_Position=2833; Antisense; ATCCTCCGAGATATCCGTTCCAAGG
>probe:Drosophila_2:1624242_at:609:371; Interrogation_Position=2898; Antisense; GAAGATTGGCATCGCACATGGACCT
>probe:Drosophila_2:1624242_at:402:153; Interrogation_Position=2913; Antisense; ACATGGACCTGTGATGGCCGGCGTT
>probe:Drosophila_2:1624242_at:275:435; Interrogation_Position=3015; Antisense; GAGGGATGGCATTCACGTGACCGAA
>probe:Drosophila_2:1624242_at:461:173; Interrogation_Position=3038; Antisense; AAAGCACTGCGAACGTTCTGCGCGA
>probe:Drosophila_2:1624242_at:95:297; Interrogation_Position=3060; Antisense; CGACTTTAACATTCGCTGCACTTAT
>probe:Drosophila_2:1624242_at:420:335; Interrogation_Position=3074; Antisense; GCTGCACTTATCGAGGGATGACCTT
>probe:Drosophila_2:1624242_at:173:557; Interrogation_Position=3141; Antisense; GGACGAGAATCTACACTTCCAACAG
>probe:Drosophila_2:1624242_at:376:27; Interrogation_Position=3167; Antisense; ATAGCCCAGATAACGATTCGCACAA
>probe:Drosophila_2:1624242_at:609:345; Interrogation_Position=3197; Antisense; GCATAGTCTCCGTGCATTGGTTAGA

Paste this into a BLAST search page for me
GAAATCTGGTTCTGTTCGCTTTGCCAATGATCAAGGATCTGCACCCCACATCCTGGTCATGACTGAATTCGCTTTGAATTCGCTTTGAACTTACTTCGCAATCCTCCGAGATATCCGTTCCAAGGGAAGATTGGCATCGCACATGGACCTACATGGACCTGTGATGGCCGGCGTTGAGGGATGGCATTCACGTGACCGAAAAAGCACTGCGAACGTTCTGCGCGACGACTTTAACATTCGCTGCACTTATGCTGCACTTATCGAGGGATGACCTTGGACGAGAATCTACACTTCCAACAGATAGCCCAGATAACGATTCGCACAAGCATAGTCTCCGTGCATTGGTTAGA

Full Affymetrix probeset data:

Annotations for 1624242_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime