Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624243_at:

>probe:Drosophila_2:1624243_at:164:447; Interrogation_Position=1498; Antisense; GATGCTCATCCAAAGGACACCGTCG
>probe:Drosophila_2:1624243_at:333:527; Interrogation_Position=1527; Antisense; GGGAGCGAGTCCTTTGAGCGCCCAA
>probe:Drosophila_2:1624243_at:716:221; Interrogation_Position=1556; Antisense; AAGGGCGCATCATCCACTGCTGTTG
>probe:Drosophila_2:1624243_at:167:311; Interrogation_Position=1569; Antisense; CCACTGCTGTTGTTGTATTTACATT
>probe:Drosophila_2:1624243_at:715:147; Interrogation_Position=1589; Antisense; ACATTATTCTTTTTCCAACGTGGAG
>probe:Drosophila_2:1624243_at:364:615; Interrogation_Position=1631; Antisense; TGAATTTCGTGTTTTTGGCGTTTTG
>probe:Drosophila_2:1624243_at:112:577; Interrogation_Position=1655; Antisense; GGCCGCGAGGAACCAATACTTAGTC
>probe:Drosophila_2:1624243_at:322:327; Interrogation_Position=1733; Antisense; GCGTTTAGCCTTAATTAATCGAATT
>probe:Drosophila_2:1624243_at:7:479; Interrogation_Position=1758; Antisense; GTATTTTTGTAATGCCTCTTAAGTT
>probe:Drosophila_2:1624243_at:592:59; Interrogation_Position=1789; Antisense; ATGTTTTGCATTTCCGATTTGCCAG
>probe:Drosophila_2:1624243_at:557:693; Interrogation_Position=1799; Antisense; TTTCCGATTTGCCAGTAGTCATCTA
>probe:Drosophila_2:1624243_at:462:679; Interrogation_Position=1814; Antisense; TAGTCATCTATACTCCCCAAGCGGA
>probe:Drosophila_2:1624243_at:135:551; Interrogation_Position=1899; Antisense; GGAGCTGTCCAATACGAAAACTGAA
>probe:Drosophila_2:1624243_at:296:339; Interrogation_Position=1925; Antisense; GCTAACTTTGTTATACGTTTACTCG

Paste this into a BLAST search page for me
GATGCTCATCCAAAGGACACCGTCGGGGAGCGAGTCCTTTGAGCGCCCAAAAGGGCGCATCATCCACTGCTGTTGCCACTGCTGTTGTTGTATTTACATTACATTATTCTTTTTCCAACGTGGAGTGAATTTCGTGTTTTTGGCGTTTTGGGCCGCGAGGAACCAATACTTAGTCGCGTTTAGCCTTAATTAATCGAATTGTATTTTTGTAATGCCTCTTAAGTTATGTTTTGCATTTCCGATTTGCCAGTTTCCGATTTGCCAGTAGTCATCTATAGTCATCTATACTCCCCAAGCGGAGGAGCTGTCCAATACGAAAACTGAAGCTAACTTTGTTATACGTTTACTCG

Full Affymetrix probeset data:

Annotations for 1624243_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime