Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624244_at:

>probe:Drosophila_2:1624244_at:306:491; Interrogation_Position=3004; Antisense; GTAAAGGTTTCCCAAGCTCGATTAT
>probe:Drosophila_2:1624244_at:648:657; Interrogation_Position=3028; Antisense; TAAAGAGTGGCCCAAAACACCTTTG
>probe:Drosophila_2:1624244_at:438:727; Interrogation_Position=3050; Antisense; TTGGGCCAAACTCCAAACTTGCTCG
>probe:Drosophila_2:1624244_at:545:191; Interrogation_Position=3065; Antisense; AACTTGCTCGCATAGCCAATTTGTA
>probe:Drosophila_2:1624244_at:397:311; Interrogation_Position=3079; Antisense; GCCAATTTGTATTCAATGACCTAAC
>probe:Drosophila_2:1624244_at:305:555; Interrogation_Position=3111; Antisense; GGAAATCCGCCTCTGTTTTTAGTCA
>probe:Drosophila_2:1624244_at:726:475; Interrogation_Position=3125; Antisense; GTTTTTAGTCAGCTCCATGCAATTG
>probe:Drosophila_2:1624244_at:78:363; Interrogation_Position=3143; Antisense; GCAATTGGTCTAATTCGATTCGATT
>probe:Drosophila_2:1624244_at:109:469; Interrogation_Position=3171; Antisense; GTTGCATTTCTGGATACAAGCTAAT
>probe:Drosophila_2:1624244_at:717:557; Interrogation_Position=3201; Antisense; GGAACAAGTTAATACCGCGTACTGA
>probe:Drosophila_2:1624244_at:119:475; Interrogation_Position=3208; Antisense; GTTAATACCGCGTACTGAGAAGCTA
>probe:Drosophila_2:1624244_at:322:609; Interrogation_Position=3223; Antisense; TGAGAAGCTAAACGCTGCCACCACA
>probe:Drosophila_2:1624244_at:426:461; Interrogation_Position=3339; Antisense; GATTATATTCCGTTTCAGTTTGCAA
>probe:Drosophila_2:1624244_at:702:479; Interrogation_Position=3356; Antisense; GTTTGCAATCTGAATCGTATTTTTT

Paste this into a BLAST search page for me
GTAAAGGTTTCCCAAGCTCGATTATTAAAGAGTGGCCCAAAACACCTTTGTTGGGCCAAACTCCAAACTTGCTCGAACTTGCTCGCATAGCCAATTTGTAGCCAATTTGTATTCAATGACCTAACGGAAATCCGCCTCTGTTTTTAGTCAGTTTTTAGTCAGCTCCATGCAATTGGCAATTGGTCTAATTCGATTCGATTGTTGCATTTCTGGATACAAGCTAATGGAACAAGTTAATACCGCGTACTGAGTTAATACCGCGTACTGAGAAGCTATGAGAAGCTAAACGCTGCCACCACAGATTATATTCCGTTTCAGTTTGCAAGTTTGCAATCTGAATCGTATTTTTT

Full Affymetrix probeset data:

Annotations for 1624244_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime