FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624245_at:

>probe:Drosophila_2:1624245_at:34:415; Interrogation_Position=1446; Antisense; GACCAAACCCGCGAGCATGTAATTG
>probe:Drosophila_2:1624245_at:332:299; Interrogation_Position=1455; Antisense; CGCGAGCATGTAATTGCCGATGGCC
>probe:Drosophila_2:1624245_at:619:439; Interrogation_Position=1473; Antisense; GATGGCCAGGTGACCGCGACTACGA
>probe:Drosophila_2:1624245_at:120:137; Interrogation_Position=1494; Antisense; ACGACGAACGGCGACCAGGTGCAGA
>probe:Drosophila_2:1624245_at:497:125; Interrogation_Position=1607; Antisense; AGCCGCAGCACCGATTGAGGGAGAA
>probe:Drosophila_2:1624245_at:432:407; Interrogation_Position=1751; Antisense; GACGGATGAGACTGGATTCGCCTAC
>probe:Drosophila_2:1624245_at:79:463; Interrogation_Position=1765; Antisense; GATTCGCCTACGAGCTCCTCAATGG
>probe:Drosophila_2:1624245_at:430:279; Interrogation_Position=1782; Antisense; CTCAATGGCATCCTGGATTTTTTCA
>probe:Drosophila_2:1624245_at:697:459; Interrogation_Position=1797; Antisense; GATTTTTTCAACTGAGCGGCCAGCG
>probe:Drosophila_2:1624245_at:116:313; Interrogation_Position=1815; Antisense; GCCAGCGCGAGTTTGCCAACATGCT
>probe:Drosophila_2:1624245_at:374:81; Interrogation_Position=1847; Antisense; AGTGTAAATACCTTGTACCGCCGCA
>probe:Drosophila_2:1624245_at:507:319; Interrogation_Position=1866; Antisense; GCCGCAGCTGGTCGACACAAATTTA
>probe:Drosophila_2:1624245_at:53:473; Interrogation_Position=1891; Antisense; GTTCATAGTTCATAGGTCGTAGCGC
>probe:Drosophila_2:1624245_at:232:645; Interrogation_Position=1900; Antisense; TCATAGGTCGTAGCGCTTAAGGGCC

Paste this into a BLAST search page for me
GACCAAACCCGCGAGCATGTAATTGCGCGAGCATGTAATTGCCGATGGCCGATGGCCAGGTGACCGCGACTACGAACGACGAACGGCGACCAGGTGCAGAAGCCGCAGCACCGATTGAGGGAGAAGACGGATGAGACTGGATTCGCCTACGATTCGCCTACGAGCTCCTCAATGGCTCAATGGCATCCTGGATTTTTTCAGATTTTTTCAACTGAGCGGCCAGCGGCCAGCGCGAGTTTGCCAACATGCTAGTGTAAATACCTTGTACCGCCGCAGCCGCAGCTGGTCGACACAAATTTAGTTCATAGTTCATAGGTCGTAGCGCTCATAGGTCGTAGCGCTTAAGGGCC

Full Affymetrix probeset data:

Annotations for 1624245_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720