Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624247_at:

>probe:Drosophila_2:1624247_at:234:613; Interrogation_Position=1553; Antisense; TGAAAACGCTGTGGCACCCAAAGCT
>probe:Drosophila_2:1624247_at:44:311; Interrogation_Position=1570; Antisense; CCAAAGCTCAACCAACTGTTCGTGA
>probe:Drosophila_2:1624247_at:295:341; Interrogation_Position=1619; Antisense; GCTATTACGATGAGCACCGCAGCAT
>probe:Drosophila_2:1624247_at:198:213; Interrogation_Position=1669; Antisense; AAGACGCATCGCAAGAGGCAGCCCA
>probe:Drosophila_2:1624247_at:189:519; Interrogation_Position=1702; Antisense; GTGGGAGTCTCCCAGATCATTACGC
>probe:Drosophila_2:1624247_at:10:565; Interrogation_Position=1748; Antisense; GGCAGGAAAAGTCCCGTACCTCGCG
>probe:Drosophila_2:1624247_at:576:421; Interrogation_Position=1783; Antisense; GAGAAGGCCCGTATGGATCCTGTCA
>probe:Drosophila_2:1624247_at:131:681; Interrogation_Position=1794; Antisense; TATGGATCCTGTCAAGTCCCAGCGA
>probe:Drosophila_2:1624247_at:346:681; Interrogation_Position=1885; Antisense; TATGTCATCCGCAATCTGGGCCTGA
>probe:Drosophila_2:1624247_at:575:545; Interrogation_Position=1932; Antisense; GGATCCCAGGGAAGCCATCTTGAAG
>probe:Drosophila_2:1624247_at:284:217; Interrogation_Position=1954; Antisense; AAGTATGCCAAGGACGCAGCCGAGA
>probe:Drosophila_2:1624247_at:597:409; Interrogation_Position=1966; Antisense; GACGCAGCCGAGAATCCTTACTGGA
>probe:Drosophila_2:1624247_at:262:599; Interrogation_Position=1983; Antisense; TTACTGGATAGCACCGGCCTACAAG
>probe:Drosophila_2:1624247_at:358:255; Interrogation_Position=2018; Antisense; CAAAGGCCATCTTCTCCGAAAAACT

Paste this into a BLAST search page for me
TGAAAACGCTGTGGCACCCAAAGCTCCAAAGCTCAACCAACTGTTCGTGAGCTATTACGATGAGCACCGCAGCATAAGACGCATCGCAAGAGGCAGCCCAGTGGGAGTCTCCCAGATCATTACGCGGCAGGAAAAGTCCCGTACCTCGCGGAGAAGGCCCGTATGGATCCTGTCATATGGATCCTGTCAAGTCCCAGCGATATGTCATCCGCAATCTGGGCCTGAGGATCCCAGGGAAGCCATCTTGAAGAAGTATGCCAAGGACGCAGCCGAGAGACGCAGCCGAGAATCCTTACTGGATTACTGGATAGCACCGGCCTACAAGCAAAGGCCATCTTCTCCGAAAAACT

Full Affymetrix probeset data:

Annotations for 1624247_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime